Flap endonuclease 1 (FEN1) proteins, which are present in all kingdoms of life, catalyze the sequence-independent hydrolysis of the bifurcated nucleic acid intermediates formed during DNA replication and repair. How FEN1s have evolved to preferentially cleave flap structures is of great interest especially in light of studies wherein mice carrying a catalytically deficient FEN1 were predisposed to cancer. Structural studies of FEN1s from phage to human have shown that, although they share similar folds, the FEN1s of higher organisms contain a 3′-extrahelical nucleotide (3′-flap) binding pocket. When presented with 5′-flap substrates having a 3′-flap, archaeal and eukaryotic FEN1s display enhanced reaction rates and cleavage site specificity. To investigate the role of this interaction, a kinetic study of human FEN1 (hFEN1) employing well defined DNA substrates was conducted. The presence of a 3′-flap on substrates reduced Km and increased multiple- and single turnover rates of endonucleolytic hydrolysis at near physiological salt concentrations. Exonucleolytic and fork-gap-endonucleolytic reactions were also stimulated by the presence of a 3′-flap, and the absence of a 3′-flap from a 5′-flap substrate was more detrimental to hFEN1 activity than removal of the 5′-flap or introduction of a hairpin into the 5′-flap structure. hFEN1 reactions were predominantly rate-limited by product release regardless of the presence or absence of a 3′-flap. Furthermore, the identity of the stable enzyme product species was deduced from inhibition studies to be the 5′-phosphorylated product. Together the results indicate that the presence of a 3′-flap is the critical feature for efficient hFEN1 substrate recognition and catalysis. Flap endonuclease 1 (FEN1) proteins, which are present in all kingdoms of life, catalyze the sequence-independent hydrolysis of the bifurcated nucleic acid intermediates formed during DNA replication and repair. How FEN1s have evolved to preferentially cleave flap structures is of great interest especially in light of studies wherein mice carrying a catalytically deficient FEN1 were predisposed to cancer. Structural studies of FEN1s from phage to human have shown that, although they share similar folds, the FEN1s of higher organisms contain a 3′-extrahelical nucleotide (3′-flap) binding pocket. When presented with 5′-flap substrates having a 3′-flap, archaeal and eukaryotic FEN1s display enhanced reaction rates and cleavage site specificity. To investigate the role of this interaction, a kinetic study of human FEN1 (hFEN1) employing well defined DNA substrates was conducted. The presence of a 3′-flap on substrates reduced Km and increased multiple- and single turnover rates of endonucleolytic hydrolysis at near physiological salt concentrations. Exonucleolytic and fork-gap-endonucleolytic reactions were also stimulated by the presence of a 3′-flap, and the absence of a 3′-flap from a 5′-flap substrate was more detrimental to hFEN1 activity than removal of the 5′-flap or introduction of a hairpin into the 5′-flap structure. hFEN1 reactions were predominantly rate-limited by product release regardless of the presence or absence of a 3′-flap. Furthermore, the identity of the stable enzyme product species was deduced from inhibition studies to be the 5′-phosphorylated product. Together the results indicate that the presence of a 3′-flap is the critical feature for efficient hFEN1 substrate recognition and catalysis. In eukaryotic DNA replication and repair, various bifurcated nucleic acid structure intermediates are formed and must be processed by the appropriate nuclease. Two examples of biological processes that create bifurcated DNA intermediates are Okazaki fragment maturation (1Kao H.I. Bambara R.A. Crit. Rev. Biochem. Mol. Biol. 2003; 38: 433-452Crossref PubMed Scopus (77) Google Scholar, 2Burgers P.M. J. Biol. Chem. 2009; 284: 4041-4045Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar) and long patch excision repair (3Robertson A.B. Klungland A. Rognes T. Leiros I. Cell. Mol. Life. Sci. 2009; 66: 981-993Crossref PubMed Scopus (439) Google Scholar). In both models, a polymerase executes strand-displacement synthesis to create a double-stranded DNA (dsDNA) 6The abbreviations used are: dsDNAdouble-stranded DNAFEN1flap endonuclease 1ssDNAsingle-stranded DNAαbα helical bundle3′-flap3′-extrahelical nucleotideFAMfluoresceind-strandduplex strandT-strandtemplate strandRBreaction bufferdHPLCdenaturing HPLCLRlinear regressionMMMichaelis-Menten modelMMhMichaelis-Menten model with Hill slopekSTmaxmaximal single turnover rateAICAkaike information criteriaKIinhibition constantENDOendonucleaseEXOexonucleasefork-GENfork-gap endonucleaseSTsingle turnoverMTmultiple turnoverntnucleotide(s). two-way junction from which a 5′-flap structure protrudes. The penultimate step of both pathways is the cleavage of this flap structure to create a nicked DNA that is then ligated. Because the bifurcated DNA structures that are formed in the aforementioned processes can theoretically occur anywhere in the genome, the nuclease associated with the cleavage of 5′-flap structures in eukaryotic cells, which is called flap endonuclease 1 (FEN1), must be capable of cleavage regardless of sequence. Therefore, FEN1 nucleases, which are found in all kingdoms of life (4Shen B. Qiu J. Hosfield D. Tainer J.A. Trends Biochem. Sci. 1998; 23: 171-173Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), have evolved to recognize substrates based upon nucleic acid structure and strand polarity (5Liu Y. Kao H.I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (306) Google Scholar, 6Shen B. Singh P. Liu R. Qiu J. Zheng L. Finger L.D. Alas S. BioEssays. 2005; 27: 717-729Crossref PubMed Scopus (116) Google Scholar). double-stranded DNA flap endonuclease 1 single-stranded DNA α helical bundle 3′-extrahelical nucleotide fluorescein duplex strand template strand reaction buffer denaturing HPLC linear regression Michaelis-Menten model Michaelis-Menten model with Hill slope maximal single turnover rate Akaike information criteria inhibition constant endonuclease exonuclease fork-gap endonuclease single turnover multiple turnover nucleotide(s). The Okazaki fragment maturation pathway of yeast has become a paradigm of eukaryotic lagging strand DNA synthesis. In the yeast model, bifurcated intermediates with large single-stranded DNA (ssDNA) 5′-flap structures are imprecisely cleaved by DNA2 in a replication protein A -dependent manner (7Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature. 2001; 412: 456-461Crossref PubMed Scopus (284) Google Scholar). Subsequent to the DNA2 cleavage, Rad27 (yeast homologue of FEN1) cleaves precisely to generate an intermediate suitable for ligation (2Burgers P.M. J. Biol. Chem. 2009; 284: 4041-4045Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). The recent discovery that human DNA2 is predominantly located in mitochondria in various human cell lines (8Zheng L. Zhou M. Guo Z. Lu H. Qian L. Dai H. Qiu J. Yakubovskaya E. Bogenhagen D.F. Demple B. Shen B. Mol. Cell. 2008; 32: 325-336Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 9Duxin J.P. Dao B. Martinsson P. Rajala N. Guittat L. Campbell J.L. Spelbrink J.N. Stewart S.A. Mol. Cell. Biol. 2009; (Jun 1 [Epub ahead of print])PubMed Google Scholar) suggests that hFEN1 is the paramount 5′-flap endonuclease in the nuclei of human cells. This observation potentially provides a plausible rationale for why deletion of RAD27 (yeast FEN1 homologue) is tolerated in Saccharomyces cerevisiae (10Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol. 1995; 177: 364-371Crossref PubMed Google Scholar), whereas deletion of FEN1 in mammals is embryonically lethal (11Larsen E. Gran C. Saether B.E. Seeberg E. Klungland A. Mol. Cell. Biol. 2003; 23: 5346-5353Crossref PubMed Scopus (109) Google Scholar). Recent models wherein mice carrying a mutation (E160D) in the FEN1 gene, which was shown in vitro to alter enzymatic properties (12Frank G. Qiu J. Somsouk M. Weng Y. Somsouk L. Nolan J.P. Shen B. J. Biol. Chem. 1998; 273: 33064-33072Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar), have demonstrated that FEN1 functional deficiency in mice (S129 and Black 6) increases the incidence of cancer, albeit different types presumably due to genetic background (13Zheng L. Dai H. Zhou M. Li M. Singh P. Qiu J. Tsark W. Huang Q. Kernstine K. Zhang X. Lin D. Shen B. Nat. Med. 2007; 13: 812-819Crossref PubMed Scopus (183) Google Scholar, 14Larsen E. Kleppa L. Meza T.J. Meza-Zepeda L.A. Rada C. Castellanos C.G. Lien G.F. Nesse G.J. Neuberger M.S. Laerdahl J.K. William Doughty R. Klungland A. Cancer Res. 2008; 68: 4571-4579Crossref PubMed Scopus (29) Google Scholar). Thus, the function of mammalian FEN1 in vivo is vital to the prevention of genomic instability. In addition to its importance in the nucleus, hFEN1 has recently been detected in mitochondrial extracts (15Liu P. Qian L. Sung J.S. de Souza-Pinto N.C. Zheng L. Bogenhagen D.F. Bohr V.A. Wilson 3rd, D.M. Shen B. Demple B. Mol. Cell. Biol. 2008; 28: 4975-4987Crossref PubMed Scopus (166) Google Scholar, 16Szczesny B. Tann A.W. Longley M.J. Copeland W.C. Mitra S. J. Biol. Chem. 2008; 283: 26349-26356Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar) and implicated in mitochondrial long patch base excision repair (15Liu P. Qian L. Sung J.S. de Souza-Pinto N.C. Zheng L. Bogenhagen D.F. Bohr V.A. Wilson 3rd, D.M. Shen B. Demple B. Mol. Cell. Biol. 2008; 28: 4975-4987Crossref PubMed Scopus (166) Google Scholar). Considering the pivotal roles of hFEN1 in DNA replication and repair, it is of interest to understand how hFEN1 and homologues achieve substrate and scissile phosphate selectivity in the absence of sequence information. Since its initial discovery as a nuclease that completes reconstituted Okazaki fragment maturation (17Goulian M. Richards S.H. Heard C.J. Bigsby B.M. J. Biol. Chem. 1990; 265: 18461-18471Abstract Full Text PDF PubMed Google Scholar) and subsequent rediscovery as a 5′-flap-specific nuclease (DNaseIV) from bacteria (18Lyamichev V. Brow M.A. Dahlberg J.E. Science. 1993; 260: 778-783Crossref PubMed Scopus (306) Google Scholar), mouse (19Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (373) Google Scholar), and HeLa cells (20Robins P. Pappin D.J. Wood R.D. Lindahl T. J. Biol. Chem. 1994; 269: 28535-28538Abstract Full Text PDF PubMed Google Scholar), FEN1 proteins ranging from phage to human have been studied biochemically, computationally, and structurally (5Liu Y. Kao H.I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (306) Google Scholar, 6Shen B. Singh P. Liu R. Qiu J. Zheng L. Finger L.D. Alas S. BioEssays. 2005; 27: 717-729Crossref PubMed Scopus (116) Google Scholar, 21Kaiser M.W. Lyamicheva N. Ma W. Miller C. Neri B. Fors L. Lyamichev V.I. J. Biol. Chem. 1999; 274: 21387-21394Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). Biochemical characterizations of FEN1 proteins from various organisms have shown that this family of nucleases can perform phosphodiesterase activity on a wide variety of substrates; however, the efficiency of catalysis on various substrates differs among the species. For instance, phage FEN1s prefer pseudo-Y substrates (22Devos J.M. Tomanicek S.J. Jones C.E. Nossal N.G. Mueser T.C. J. Biol. Chem. 2007; 282: 31713-31724Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 23Williams R. Sengerová B. Osborne S. Syson K. Ault S. Kilgour A. Chapados B.R. Tainer J.A. Sayers J.R. Grasby J.A. J. Mol. Biol. 2007; 371: 34-48Crossref PubMed Scopus (18) Google Scholar), whereas the archaeal and eukaryotic FEN1s prefer 5′-flap substrates (21Kaiser M.W. Lyamicheva N. Ma W. Miller C. Neri B. Fors L. Lyamichev V.I. J. Biol. Chem. 1999; 274: 21387-21394Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 24Harrington J.J. Lieber M.R. J. Biol. Chem. 1995; 270: 4503-4508Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 25Hosfield D.J. Frank G. Weng Y. Tainer J.A. Shen B. J. Biol. Chem. 1998; 273: 27154-27161Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), which have two dsDNA domains, one upstream and downstream of the site of cleavage, and a 5′-ssDNA protrusion (Fig. 1A). Primary sequence analysis indicates that FEN1 proteins share characteristic N-terminal (N) and Intermediate (I) "domains," which harbor the highly conserved carboxylate residues that bind the requisite divalent metal ions (26Xu Y. Derbyshire V. Ng K. Sun X.C. Grindley N.D. Joyce C.M. J. Mol. Biol. 1997; 268: 284-302Crossref PubMed Scopus (51) Google Scholar, 27Zheng L. Li M. Shan J. Krishnamoorthi R. Shen B. Biochemistry. 2002; 41: 10323-10331Crossref PubMed Scopus (28) Google Scholar, 28Syson K. Tomlinson C. Chapados B.R. Sayers J.R. Tainer J.A. Williams N.H. Grasby J.A. J. Biol. Chem. 2008; 283: 28741-28746Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Structural studies of FEN1 nucleases from phage to humans (22Devos J.M. Tomanicek S.J. Jones C.E. Nossal N.G. Mueser T.C. J. Biol. Chem. 2007; 282: 31713-31724Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 29Kim Y. Eom S.H. Wang J. Lee D.S. Suh S.W. Steitz T.A. Nature. 1995; 376: 612-616Crossref PubMed Scopus (329) Google Scholar, 30Ceska T.A. Sayers J.R. Stier G. Suck D. Nature. 1996; 382: 90-93Crossref PubMed Scopus (165) Google Scholar, 31Mueser T.C. Nossal N.G. Hyde C.C. Cell. 1996; 85: 1101-1112Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 32Hosfield D.J. Mol C.D. Shen B. Tainer J.A. Cell. 1998; 95: 135-146Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 33Hwang K.Y. Baek K. Kim H.Y. Cho Y. Nat. Struct. Biol. 1998; 5: 707-713Crossref PubMed Scopus (149) Google Scholar, 34Matsui E. Musti K.V. Abe J. Yamasaki K. Matsui I. Harata K. J. Biol. Chem. 2002; 277: 37840-37847Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 35Chapados B.R. Hosfield D.J. Han S. Qiu J. Yelent B. Shen B. Tainer J.A. Cell. 2004; 116: 39-50Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar, 36Sakurai S. Kitano K. Yamaguchi H. Hamada K. Okada K. Fukuda K. Uchida M. Ohtsuka E. Morioka H. Hakoshima T. EMBO J. 2005; 24: 683-693Crossref PubMed Scopus (197) Google Scholar), have shown that the N and I domains comprise a single nuclease core domain consisting of a mixed, six- or seven-stranded β-sheet packed against an α-helical structure on both sides. The α-helices on either side of the β-sheet are "bridged" by a helical arch that spans the active site groove (supplemental Fig. S1). On one side of the β-sheet, the α-helical bundle (αb1) creates the floor of the active site and a DNA binding motif (helix-3-turn-helix) (32Hosfield D.J. Mol C.D. Shen B. Tainer J.A. Cell. 1998; 95: 135-146Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). Similarly, the opposite α-helical bundle (αb2) has also been observed to interact with DNA (35Chapados B.R. Hosfield D.J. Han S. Qiu J. Yelent B. Shen B. Tainer J.A. Cell. 2004; 116: 39-50Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). Based on site-directed mutagenesis studies with T5 phage FEN1 (T5FEN1) (37Dervan J.J. Feng M. Patel D. Grasby J.A. Artymiuk P.J. Ceska T.A. Sayers J.R. Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 8542-8547Crossref PubMed Scopus (24) Google Scholar) and hFEN1 (38Qiu J. Liu R. Chapados B.R. Sherman M. Tainer J.A. Shen B. J. Biol. Chem. 2004; 279: 24394-24402Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar, 39Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res. 2006; 34: 1772-1784Crossref PubMed Scopus (34) Google Scholar), and crystallographic studies of T4 phage FEN1 (T4FEN1) (22Devos J.M. Tomanicek S.J. Jones C.E. Nossal N.G. Mueser T.C. J. Biol. Chem. 2007; 282: 31713-31724Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) and Archaeoglobus fulgidus FEN1 (aFEN1) (35Chapados B.R. Hosfield D.J. Han S. Qiu J. Yelent B. Shen B. Tainer J.A. Cell. 2004; 116: 39-50Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar) in complex with DNA, a general model for how FEN1 proteins recognize flap DNA has emerged. The helix-3-turn-helix motif is involved in downstream dsDNA binding, whereas the upstream dsDNA domain is bound by αb2. The helical arch is likely involved in 5′-flap binding (22Devos J.M. Tomanicek S.J. Jones C.E. Nossal N.G. Mueser T.C. J. Biol. Chem. 2007; 282: 31713-31724Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Unlike phage FEN1s, studies of FEN1s from eubacterial (40Xu Y. Potapova O. Leschziner A.E. Grindley N.D. Joyce C.M. J. Biol. Chem. 2001; 276: 30167-30177Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar), archaeal (21Kaiser M.W. Lyamicheva N. Ma W. Miller C. Neri B. Fors L. Lyamichev V.I. J. Biol. Chem. 1999; 274: 21387-21394Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar), and eukaryotic origins (41Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem. 2002; 277: 14379-14389Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) have shown that the addition of a 3′-extrahelical nucleotide (3′-flap) to the upstream duplex of a 5′-flap substrate results in a rate enhancement and an increase in cleavage site specificity. Moreover, substrates possessing a 3′-flap, which mimic physiological "equilibrating flaps," were cleaved exactly one nucleotide into the downstream duplex, thereby resulting in 5′-phosphorylated dsDNA product that was a suitable substrate for DNA ligase I (21Kaiser M.W. Lyamicheva N. Ma W. Miller C. Neri B. Fors L. Lyamichev V.I. J. Biol. Chem. 1999; 274: 21387-21394Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 41Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem. 2002; 277: 14379-14389Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). As postulated by Kaiser et al. (21Kaiser M.W. Lyamicheva N. Ma W. Miller C. Neri B. Fors L. Lyamichev V.I. J. Biol. Chem. 1999; 274: 21387-21394Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar), the structure of an archaeal FEN1 in complex with dsDNA with a 3′-overhang showed that the protein contains a cleft adjacent to the upstream dsDNA binding site that binds the 3′-flap by means of van der Waals and hydrogen bonding interactions with the sugar moiety (35Chapados B.R. Hosfield D.J. Han S. Qiu J. Yelent B. Shen B. Tainer J.A. Cell. 2004; 116: 39-50Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). Once the residues associated with 3′-flap binding were identified, sequence alignment analyses showed that the amino acid residues in the 3′-flap binding pocket are highly conserved from archaea to human. Furthermore, mutation of the conserved amino acid residues in the 3′-flap binding pocket of hFEN1 resulted in reduced affinity for and cleavage specificity on double flap substrates (42Friedrich-Heineken E. Hübscher U. Nucleic Acids Res. 2004; 32: 2520-2528Crossref PubMed Scopus (26) Google Scholar). Although the effects of the addition of a 3′-flap to substrates on hFEN1 catalysis are known qualitatively, a detailed understanding of the relationship between changes in catalytic parameters and rate enhancement by the presence of a 3′-flap is unknown. Here, we describe a detailed kinetic analysis of hFEN1 using four well characterized DNA substrates and show that the presence of a 3′-flap on a substrate not only contributes to substrate binding (42Friedrich-Heineken E. Hübscher U. Nucleic Acids Res. 2004; 32: 2520-2528Crossref PubMed Scopus (26) Google Scholar), but also increases multiple and single turnover rates of reaction in the presence of near physiological monovalent salt concentrations. We also demonstrate that, like T5FEN1, hFEN1 is rate-limited by product release, and thus multiple turnover rates at saturating concentrations of substrate are predominantly a reflection of product release and not catalysis as was previously concluded (39Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res. 2006; 34: 1772-1784Crossref PubMed Scopus (34) Google Scholar). Furthermore, this study provides insight into the mechanism of hFEN1 substrate recognition. Wild-type human FEN1 (hFEN1, accession code NP_004102) bearing a C-terminal His6 tag was expressed from a pET28b vector in BL21(DE3) and purified as previously described (43Singh P. Zheng L. Chavez V. Qiu J. Shen B. J. Biol. Chem. 2007; 282: 3465-3477Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). The protein was further purified by anion-exchange chromatography and then dialyzed against 2 × 1 liter of storage buffer (50 mm HEPES, pH 7.5, 100 mm NaCl, 10% glycerol, 0.02% NaN3, 1 mm dithiothreitol). The concentration of protein was determined using A280 and the calculated extinction coefficient (22,920 m−1·cm−1). For kinetic assays stocks of hFEN1 (final concentration of 100 nm or 25 μm) were prepared in 50 mm HEPES-K+, pH 7.8, 100 mm KCl, 0.1 mg/ml bovine serum albumin, 5 mm tris(3-hydroxypropyl)phosphine, 50% glycerol and stored at −20 °C. The DNA oligonucleotides listed in Table 1 were purchased from Integrated DNA Technologies, Inc. through the City of Hope DNA/RNA/peptide core facility. Except for P6 and the fluorescein-labeled (FAM) oligonucleotides, the oligonucleotides were purified as previously described (44Wu H. Finger L.D. Feigon J. Methods Enzymol. 2005; 394: 525-545Crossref PubMed Scopus (37) Google Scholar), desalted using HiTrap columns, and lyophilized to dryness. After dissolution in TE buffer (10 mM Tris, pH 8.0, 1 mM EDTA), the concentrations were determined from calculated extinction coefficients.TABLE 1The oligonucleotide sequences used in this studyOligonucleotideTypeaRefers to the type of oligonucleotide it is for the establishment of the correct ratio for folding. See "Experimental Procedures."SequenceP65′Phos-TTTTTA3′Qd5′Phos-GTTAGGACTGCTCGTCATC3′E1bThese two oligonucleotides differ by the absence or presence of a 5′-phosphate monoester.d5′AGTTAGGACTGCTCGTCATC3′E2bThese two oligonucleotides differ by the absence or presence of a 5′-phosphate monoester.d5′Phos-AGTTAGGACTGCTCGTCATC3′F(5)d5′Phos-TTTTTAGTTAGGACTGCTCGTCATC3′G(15)d5′CTGGCACTTCGGAGAAGTGCCAGTTTTTTTTTTTTTTTAGTTAGGACTGCTCGTCATC3′TT5′GATGACGAGCAGTCCTAACTGGAAATCTAGCTCTGTGGAGGAACTCCACAGAGCTAGATTTCC3′T3FT5′GATGACGAGCAGTCCTAACTGGAAATCTAGCTCTGTGGAGGAACTCCACAGAGCTAGATTTCCC3′f-Nd(FAM)-5′AGTTAGGACTGCTCGTCATC3′f-F(5)d(FAM)-5′TTTTTAGTTAGGACTGCTCGTCATC3′G(15)-fd5′CTGGCACTTCGGAGAAGTGCCAGTTTTTTTTTTTTTTTAGTTAGGACTGCTCGTCATC3′-(FAM)a Refers to the type of oligonucleotide it is for the establishment of the correct ratio for folding. See "Experimental Procedures."b These two oligonucleotides differ by the absence or presence of a 5′-phosphate monoester. Open table in a new tab The P6 oligonucleotide was purified by reversed-phase HPLC (Waters Xbridge 10 × 250 mm C-18 column) using buffer A (100 mm triethylammonium acetate, pH 7.2) and buffer B (100 mm triethylammonium acetate, pH 7.2, 90% acetonitrile). The gradient conditions were t = 0 min, 0% B; t = 5 min, 7.5% B; t = 20 min, 10.5% B; t = 25 min, 10.5% B; t = 25.1 min, 100% B; t = 30 min, 100% B; and t = 31 min, 0% B. The purified P6 was dried and repeatedly lyophilized to remove volatile salts. The 5′- and 3′-FAM oligonucleotides were HPLC-purified by the manufacturer, and concentrations were determined as above. All thermal melting experiments were conducted and analyzed as previously described (45Theimer C.A. Wang Y. Hoffman D.W. Krisch H.M. Giedroc D.P. J. Mol. Biol. 1998; 279: 545-564Crossref PubMed Scopus (46) Google Scholar) with the exception that the data were collected on a Varian Cary 300 scanning spectrophotometer. DNA stock (40 μm) samples were prepared at 1:1.1 ratio of d to T strand (Table 1) in 1× sequence annealing buffer (25 mm HEPES-K+, pH 7.5, 50 mm NaCl, 0.1 mm EDTA), heated to 95 °C, and cooled to room temperature on the bench. Melt samples were prepared by dilution with 1× sequence annealing buffer of stock to give an A260 of 0.6. For bimolecular transitions, ΔH° was determined by linear regression using Prism 5.01 of a plot of the inverse of the melting temperature versus the natural log of the sum of the strand in excess (T-strand; CT-strand) and half the total concentration of the limiting strand (d-strand; Cd-strand) (46SantaLucia Jr., J. Proc. Natl. Acad. Sci. U.S.A. 1998; 95: 1460-1465Crossref PubMed Scopus (2293) Google Scholar). R is the gas constant (1.987 cal·K−1·mol−1) (Equation 1). 1tmRΔH°In[CT-strand+(Cd-strand2)]+ΔS°ΔH°Eq. 1 The indicated d-strand oligonucleotides (Table 1) were 32P-radiolabeled at either the 3′ terminus with [α-32P]cordycepin 5′-triphosphate or the 5′ terminus with [γ-32P]ATP using conventional methods (47Sambrook J. Russell D.W. Argentine J. Molecular Cloning: A Laboratory Manual. 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001: 9.60-9.61Google Scholar), and substrates were similarly prepared as described above. Excess radiolabel was removed using Micro-Biospin 6 columns (Bio-Rad, SSC buffer). Reaction mixtures contained 1 nm radiolabeled substrate in 1× reaction buffer (RB, 50 mm HEPES-K+, pH 7.5, 0.1 mg/ml bovine serum albumin, 5% glycerol, 2.5 mm tris(3-hydroxypropyl)phosphine), with 8 mm Mg(OAc)2, 100 mm KCl, and the indicated concentrations of hFEN1. Aliquots of the reaction mixture were removed at the indicated time intervals and quenched by addition of an equal volume of 2× formamide loading buffer containing 20 mm EDTA. Product formation was assessed by phosphorimaging (ImageQuant version 5.2) after denaturing PAGE (20%). Reaction mixtures containing various concentrations of F(5)·T3F (2.5, 25, 250, or 2500 nm) were prepared in 1× RB with 8 mm Mg(OAc)2 and varying concentrations of KCl (0–225 mm). To determine the Mg2+ optimum at 100 mm KCl, reaction mixtures were prepared containing 25 nm F(5)·T3F substrate in 1× RB (with 100 mm KCl) and varying Mg(OAc)2 concentrations (2–10 mm). Reaction mixtures were preincubated at 37 °C before initiation by the addition of hFEN1. The reactions were quenched after 6 min by the addition of 100 mm EDTA, 8 m urea. Reaction progress was assessed by dHPLC using a WAVE System 3500 (Trangenomics, Inc., Omaha, NB) (supplemental Table S1) with fluorescence detector and an Oligo Sep® cartridge as previously described (48Patel D. Tock M.R. Frary E. Feng M. Pickering T.J. Grasby J.A. Sayers J.R. J. Mol. Biol. 2002; 320: 1025-1035Crossref PubMed Scopus (12) Google Scholar). The amount of product was determined by integration using NavigatorTM version 1.7 (Transgenomics, Inc.) of substrate and product peaks in fluorescence intensity traces. Cleavage at all substrate concentrations was maintained below 15% to mitigate substrate depletion. Activity was defined as the amount of product produced per unit assay time, where one unit of assay time is 6 min. The normalized activity was defined as the quotient of activity and the enzyme concentration used. Reaction mixtures were prepared with varying concentrations of substrates and preincubated at 37 °C before the addition of enzyme to initiate the reaction. The final concentrations of all buffer components were 1× RB with 100 mm KCl, 5 mm NaCl, and 8 mm Mg(OAc)2. Final substrate/hFEN1 concentrations for reactions containing F(5)·T3F, E·T3F, G(15)·T3F, and F(5)·T ranged from 1.3–2000 nm/1.3–200 pm, 2.5–2000 nm/5–400 pm, 5–3600 nm/5–400 pm, and 5–3600 nm/0.1–1600 pm, respectively. Aliquots of each reaction mixture were removed and quenched with 100 mm EDTA, 8 m urea at eight time intervals between 0 and 8 min. Reaction progress was monitored by dHPLC. All reactions were independently repeated at least six times. Initial rates (νo, nm·min−1) were determined by linear regression of plots of the amount of product versus time. Normalized initial rates (νo/[E]o, min−1) were obtained from the quotient of initial rate and enzyme concentration used. Kinetic parameters kcat and Km were determined by generalized nonlinear least squares using a Michaelis-Menten model (MM, Equation 2) or MM model with a Hill slope (MMh, Equation 3), from which plots of normalized initial rate as a function of substrate concentration were generated (49Segel I.H. Biochemical Calculations: How to Solve Mathematical Problems in General Biochemistry.2nd Ed. John Wiley & Sons, Inc., New York1975: 208-323Google Scholar). (See statistical analysis.) v°[E]°=kcat[A]kM+[A]Eq. 2 v°[E]°=kcat[A]hkMh+[A]hEq. 3 The contribution of a specific substrate structural feature to the overall binding energy (ΔΔGb) was calculated using Equation 4 (50Fersht A. Enzyme Structure and Mechanism.2nd Ed. W. H. Freeman and Company, New York1985Google Scholar), R is the gas constant (8.314 J·mol−1·K−1) and T is 310.15 K. ΔΔGb=-RTIn(kcat/km)F(5).T3F(kcat/km)substrateEq. 4 Rapid quench experiments were conducted at 37 °C using an RQF-63 device from HiTech Ltd. (Salisbury, UK) as previously described (23Williams R. Sengerová B. Osborne S. Syson K. Ault S. Kilgour A. Chapados B.R. Tainer J.A. Sayers J.R. Grasby J.A. J. Mol. Biol. 2007; 371: 34-48Crossref PubMed Scopus (18) Google Scholar, 48Patel D. Tock M.R. Frary E. Feng M. Pickering T.J. Grasby J.A. Sayers J.R. J. Mol. Biol. 2002; 320: 1025-1035Crossref PubMed Scopus (12) Google Scholar). Briefly, an 80-μl aliquot of enzyme in reaction buffer (50 mm HEPES-K+, pH 7.5, 0.1 mg/ml bovine serum albumin, 2.5 mm tris(3-hydroxypropyl)phosphine, 8 mm Mg(OAc)2, 100 mm KCl) was mixed with an equal volume of substrate in reaction buffer. Enzyme was used at a final concentration of at
Abstract DNA replication and repair enzyme Flap Endonuclease 1 (FEN1) is vital for genome integrity, and FEN1 mutations arise in multiple cancers. FEN1 precisely cleaves single-stranded (ss) 5′-flaps one nucleotide into duplex (ds) DNA. Yet, how FEN1 selects for but does not incise the ss 5′-flap was enigmatic. Here we combine crystallographic, biochemical and genetic analyses to show that two dsDNA binding sites set the 5′polarity and to reveal unexpected control of the DNA phosphodiester backbone by electrostatic interactions. Via ‘phosphate steering’, basic residues energetically steer an inverted ss 5′-flap through a gateway over FEN1’s active site and shift dsDNA for catalysis. Mutations of these residues cause an 18,000-fold reduction in catalytic rate in vitro and large-scale trinucleotide (GAA) n repeat expansions in vivo , implying failed phosphate-steering promotes an unanticipated lagging-strand template-switch mechanism during replication. Thus, phosphate steering is an unappreciated FEN1 function that enforces 5′-flap specificity and catalysis, preventing genomic instability.
Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5′-duplex.
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)
