Flaxseed is high in ω-3 polyunsaturated fatty acids, fiber, and lignans known to lower cholesterol levels. However, its use for prevention or treatment of inflammatory bowel diseases has yielded mixed results, perhaps related to dietary interactions. In this study, we evaluated the impact of ground flaxseed supplementation on the severity of Citrobacter rodentium-induced colitis in the setting of either a high-fat (HF, ~36%kcal) or reduced-fat (RF, ~12%kcal) diet. After weaning, C57BL/6 mice ( n = 8-15/treatment) were fed ground flaxseed (7 g/100 g diet) with either HF (HF Flx) or RF (RF Flx) diets for 4 wk before infection with C. rodentium or sham gavage. Weight changes, mucosal inflammation, pathogen burden, gut microbiota composition, tissue polyunsaturated fatty acids, and cecal short-chain fatty acids were compared over a 14-day infection period. The RF diet protected against C. rodentium-induced colitis, whereas the RF Flx diet increased pathogen burden, exacerbated gut inflammation, and promoted gut dysbiosis. When compared with the RF diet, both HF and HF Flx diets resulted in more severe pathology in response to C. rodentium infection. Our findings demonstrate that although an RF diet protected against C. rodentium-induced colitis and associated gut dysbiosis in mice, beneficial effects were diminished with ground flaxseed supplementation. NEW & NOTEWORTHY Our results demonstrate a strong protective effect of a reduced-fat diet against intestinal inflammation, dysbiosis, and pathogen burden during Citrobacter rodentium-induced colitis. However, ground flaxseed supplementation in the setting of a reduced-fat diet exacerbated colitis despite higher levels of intestinal n-3 polyunsaturated fatty acids and cecal short-chain fatty acids.
ERp57 is a thiol oxidoreductase that catalyzes disulfide formation in heavy chains of class I histocompatibility molecules. It also forms a mixed disulfide with tapasin within the class I peptide loading complex, stabilizing the complex and promoting efficient binding of peptides to class I molecules. Since ERp57 associates with the lectin chaperones calnexin and calreticulin, it is thought that ERp57 requires these chaperones to gain access to its substrates. To test this idea, we examined class I biogenesis in cells lacking calnexin or calreticulin or that express an ERp57 mutant that fails to bind to these chaperones. Remarkably, heavy chain disulfides formed at the same rate in these cells as in wild type cells. Moreover, ERp57 formed a mixed disulfide with tapasin and promoted efficient peptide loading in the absence of interactions with calnexin and calreticulin. These findings suggest that ERp57 has the capacity to recognize its substrates directly in addition to being recruited through lectin chaperones. We also found that calreticulin could be recruited into the peptide loading complex in the absence of interactions with both ERp57 and substrate oligosaccharides, demonstrating the importance of its polypeptide binding site in substrate recognition. Finally, by inactivating the redox-active sites of ERp57, we demonstrate that its enzymatic activity is dispensable in stabilizing the peptide loading complex and in supporting efficient peptide loading. Thus, ERp57 appears to play a structural rather than catalytic role within the peptide loading complex. ERp57 is a thiol oxidoreductase that catalyzes disulfide formation in heavy chains of class I histocompatibility molecules. It also forms a mixed disulfide with tapasin within the class I peptide loading complex, stabilizing the complex and promoting efficient binding of peptides to class I molecules. Since ERp57 associates with the lectin chaperones calnexin and calreticulin, it is thought that ERp57 requires these chaperones to gain access to its substrates. To test this idea, we examined class I biogenesis in cells lacking calnexin or calreticulin or that express an ERp57 mutant that fails to bind to these chaperones. Remarkably, heavy chain disulfides formed at the same rate in these cells as in wild type cells. Moreover, ERp57 formed a mixed disulfide with tapasin and promoted efficient peptide loading in the absence of interactions with calnexin and calreticulin. These findings suggest that ERp57 has the capacity to recognize its substrates directly in addition to being recruited through lectin chaperones. We also found that calreticulin could be recruited into the peptide loading complex in the absence of interactions with both ERp57 and substrate oligosaccharides, demonstrating the importance of its polypeptide binding site in substrate recognition. Finally, by inactivating the redox-active sites of ERp57, we demonstrate that its enzymatic activity is dispensable in stabilizing the peptide loading complex and in supporting efficient peptide loading. Thus, ERp57 appears to play a structural rather than catalytic role within the peptide loading complex. Major histocompatibility complex (MHC) 2The abbreviations used are: MHC, major histocompatibility complex; β2m, β2-microglobulin; Cnx, calnexin; Crt, calreticulin; CTL, cytotoxic T lymphocytes; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; ER, endoplasmic reticulum; H chain, heavy chain; mAb, monoclonal antibody; NEM, N-ethylmaleimide; PDI, protein-disulfide isomerase; PLC, peptide loading complex; siRNA, small interfering RNA; RNAi, RNA interference; HA, hemagglutinin; Ab, antibody; PBS, phosphate-buffered saline; MES, 4-morpholineethanesulfonic acid. class I molecules present antigenic peptides to cytotoxic T lymphocytes (CTL), which leads to the elimination of virus-infected cells. MHC class I molecules are heterotrimers consisting of a transmembrane heavy chain (H chain), a soluble subunit termed β2-microglobulin (β2m), and a peptide ligand of 8-10 residues. Assembly of class I molecules begins in the endoplasmic reticulum (ER), where the glycosylated H chain binds to the membrane-bound lectin chaperone calnexin (Cnx) and its associated thiol oxidoreductase, ERp57. At this early stage, the two highly conserved disulfide bonds within the H chain are formed, and the H chain assembles with β2m. H chain-β2m heterodimers then enter a peptide loading complex (PLC), where class I molecules acquire peptides for display to CTL. The PLC consists of calreticulin (Crt), the soluble paralog of Cnx, an associated ERp57 molecule, a peptide transporter termed TAP, and tapasin, which is the nucleus of the PLC, bridging the interaction between class I heterodimers and the TAP peptide transporter. Once peptides are translocated into the ER by TAP, a subset bind to receptive H chain-β2m heterodimers with high affinity, triggering dissociation of class I molecules from the PLC and their subsequent export from the ER to the cell surface (1Garbi N. Tanaka S. van den Broek M. Momburg F. Hammerling G.J. Immunol. Rev. 2005; 207: 77-88Crossref PubMed Scopus (33) Google Scholar, 2Peaper D.R. Cresswell P. Annu. Rev. Cell Dev. Biol. 2008; 24: 343-368Crossref PubMed Scopus (162) Google Scholar). Although the functions of most of the participants in class I biogenesis are well understood, the details of how ERp57 functions in this process and its interplay with Cnx and Crt are less clear. ERp57 is one of at least 17 members of the mammalian protein-disulfide isomerase (PDI) family within the ER (3Ellgaard L. Ruddock L.W. EMBO Rep. 2005; 6: 28-32Crossref PubMed Scopus (631) Google Scholar), and it catalyzes disulfide formation, isomerization, and reduction reactions in vitro through two CXXC active site motifs residing within thioredoxin-like domains (4Antoniou A.N. Ford S. Alphey M. Osborne A. Elliott T. Powis S.J. EMBO J. 2002; 21: 2655-2663Crossref PubMed Scopus (91) Google Scholar, 5Frickel E.M. Frei P. Bouvier M. Stafford W.F. Helenius A. Glockshuber R. Ellgaard L. J. Biol. Chem. 2004; 279: 18277-18287Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). Unlike other PDI family members that recognize substrates directly, ERp57 has been shown to require the presence of Cnx or Crt to promote disulfide bond formation in glycosylated substrates in vitro (6Zapun A. Darby N.J. Tessier D.C. Michalak M. Bergeron J.J. Thomas D.Y. J. Biol. Chem. 1998; 273: 6009-6012Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar). Cnx and Crt recognize glycoprotein folding intermediates through a lectin site specific for Glc1Man5-9GlcNAc2 oligosaccharides as well as through a polypeptide binding site that recognizes nonnative protein conformers (7Helenius A. Aebi M. Annu. Rev. Biochem. 2004; 73: 1019-1049Crossref PubMed Scopus (1630) Google Scholar, 8Williams D.B. J. Cell Sci. 2006; 119: 615-623Crossref PubMed Scopus (379) Google Scholar). Both sites reside within the globular lectin domain of Cnx and Crt, whereas the binding site for ERp57 resides at the tip of a second, extended arm domain (9Frickel E.M. Riek R. Jelesarov I. Helenius A. Wuthrich K. Ellgaard L. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1954-1959Crossref PubMed Scopus (242) Google Scholar, 10Leach M.R. Cohen-Doyle M.F. Thomas D.Y. Williams D.B. J. Biol. Chem. 2002; 277: 29686-29697Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 11Schrag J.D. Bergeron J.J. Li Y. Borisova S. Hahn M. Thomas D.Y. Cygler M. Mol. Cell. 2001; 8: 633-644Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). These sites are thought to act coordinately to bring ERp57 into the proximity of folding glycoproteins (6Zapun A. Darby N.J. Tessier D.C. Michalak M. Bergeron J.J. Thomas D.Y. J. Biol. Chem. 1998; 273: 6009-6012Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar). In the case of class I molecules, ERp57 has been shown to promote early H chain disulfide formation in vivo; depletion of ERp57 by RNA interference slowed the rate of formation of fully oxidized H chains by as much as 10-fold (12Zhang Y. Baig E. Williams D.B. J. Biol. Chem. 2006; 281: 14622-14631Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). However, a requirement for Cnx or Crt in this process was not examined, and it remains an open question whether these chaperones are essential for the full functionality of ERp57 in living cells, either for class I molecules or for other glycoprotein substrates. ERp57 also functions at a later stage in class I biogenesis, at the level of the PLC. In addition to binding to Crt within the PLC, it forms a stable mixed disulfide conjugate with tapasin that involves Cys-57 of ERp57 and Cys-95 of tapasin (13Dick T.P. Bangia N. Peaper D.R. Cresswell P. Immunity. 2002; 16: 87-98Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar). Garbi et al. (14Garbi N. Tanaka S. Momburg F. Hammerling G.J. Nat. Immunol. 2006; 7: 93-102Crossref PubMed Scopus (188) Google Scholar) demonstrated that knock-out of ERp57 results in reduced stability of the PLC, lower surface expression of class I molecules, and decreased peptide presentation to CTL. Yet it remains unclear how ERp57 affects peptide loading of class I molecules within the PLC. It has been shown that mutagenesis of Cys-95 to Ala in tapasin to prevent formation of the ERp57-tapasin conjugate results in partially reduced class I H chains within the PLC (13Dick T.P. Bangia N. Peaper D.R. Cresswell P. Immunity. 2002; 16: 87-98Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar). This has led to the suggestion that the reductase activity of ERp57 is restrained by tapasin so as to keep the class I H chain in a fully oxidized and peptide-receptive state within the PLC (15Kienast A. Preuss M. Winkler M. Dick T.P. Nat. Immunol. 2007; 8: 864-872Crossref PubMed Scopus (79) Google Scholar). Additional studies have suggested that ERp57 is solely a structural component that stabilizes the PLC (14Garbi N. Tanaka S. Momburg F. Hammerling G.J. Nat. Immunol. 2006; 7: 93-102Crossref PubMed Scopus (188) Google Scholar) and that ERp57 in conjugation with tapasin edits peptide loading onto class I molecules, favoring high affinity peptides (16Wearsch P.A. Cresswell P. Nat. Immunol. 2007; 8: 873-881Crossref PubMed Scopus (193) Google Scholar). It remains unclear whether ERp57 actually requires its enzymatic activity to function within the PLC, and the importance of its interaction with Crt within the PLC has not been established. In this study, we take a mutagenesis approach, combined with RNAi, to examine the relationship between ERp57 and the lectin chaperones Cnx and Crt at early stages of oxidative H chain folding as well as during peptide loading in the PLC. We also examine the functions of active site mutants of ERp57 to assess the importance of its catalytic activities within the PLC. We show for the first time that ERp57 can catalyze H chain disulfide formation in the absence of interactions with Cnx and Crt and can also be recruited normally into the PLC. Thus, in living cells, ERp57 can gain access to H chains and tapasin without recruitment by lectin chaperones. Furthermore, catalytically inactive ERp57, lacking all active site cysteines except for Cys-57 that forms the conjugate with tapasin, was able to promote peptide loading in a manner similar to wild type ERp57. This suggests that ERp57 functions in a structural rather than a catalytic manner to assist tapasin in stabilizing the PLC and promoting the loading of optimal peptides onto class I molecules. Finally, we show that Crt can be incorporated into the PLC in the simultaneous absence of its lectin and ERp57-binding functions, illustrating the importance of polypeptide-based interactions in recognition of the class I substrate. Cell Lines and Antibodies-Wild type (ERp57+/+) and ERp57 knock-out (ERp57-/-) mouse fibroblasts (14Garbi N. Tanaka S. Momburg F. Hammerling G.J. Nat. Immunol. 2006; 7: 93-102Crossref PubMed Scopus (188) Google Scholar) were maintained in high glucose Dulbecco's modified Eagle's medium (DMEM; Sigma) supplemented with 10% fetal bovine serum, 2 mm l-glutamine, and antibiotics. Wild type (K41) and Crt knock-out (K42) mouse embryonic fibroblasts (17Nakamura K. Zuppini A. Arnaudeau S. Lynch J. Ahsan I. Krause R. Papp S. De Smedt H. Parys J.B. Muller-Esterl W. Lew D.P. Krause K.H. Demaurex N. Opas M. Michalak M. J. Cell Biol. 2001; 154: 961-972Crossref PubMed Scopus (237) Google Scholar) as well as K42 cells transfected with various mutant Crt constructs were maintained in RPMI 1640 medium with fetal bovine serum, glutamine, and antibiotics. Mouse L cells stably expressing the class I molecules, H-2Kb or H-2Dd, were cultured in DMEM supplemented with fetal bovine serum, glutamine, and antibiotics. Antibodies used in this study were as follows: anti-8, a rabbit polyclonal antiserum, which recognizes all conformational states of the Kb molecule (18Smith M.H. Parker J.M. Hodges R.S. Barber B.H. Mol. Immunol. 1986; 23: 1077-1092Crossref PubMed Scopus (41) Google Scholar); monoclonal antibody (mAb) 34-2-12S, which recognizes the folded α3 domain of Dd molecules with an intact disulfide bond (19Ozato K. Mayer N.M. Sachs D.H. Transplantation. 1982; 34: 113-120Crossref PubMed Scopus (431) Google Scholar, 20Ribaudo R.K. Margulies D.H. J. Immunol. 1992; 149: 2935-2944PubMed Google Scholar); and mAbs Y3 (21Ozato K. Sachs D.H. J. Immunol. 1981; 126: 317-321PubMed Google Scholar) and B22.249 R1 (22Lemke H. Hammerling G.J. Hammerling U. Immunol. Rev. 1979; 47: 175-206Crossref PubMed Scopus (357) Google Scholar), which react with β2 m-associated H-2Kb and H-2Db, respectively. Rabbit antisera directed against murine tapasin (23Suh W.K. Derby M.A. Cohen-Doyle M.F. Schoenhals G.J. Fruh K. Berzofsky J.A. Williams D.B. J. Immunol. 1999; 162: 1530-1540PubMed Google Scholar), murine Crt (24Ireland B.S. Brockmeier U. Howe C.M. Elliott T. Williams D.B. Mol. Biol. Cell. 2008; 19: 2413-2423Crossref PubMed Scopus (51) Google Scholar), canine Cnx (25Danilczyk U.G. Williams D.B. J. Biol. Chem. 2001; 276: 25532-25540Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), and murine ERp57 (12Zhang Y. Baig E. Williams D.B. J. Biol. Chem. 2006; 281: 14622-14631Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar) have been described previously. Anti-TAP1 antiserum was a kind gift from Dr. Y. Yang (Johnson & Johnson Pharmaceutical Research and Development, San Diego, CA). Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis-RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). Following reverse transcription with oligo(dT) primer and Stratascript reverse transcriptase (Stratagene), ERp57 cDNA was amplified by PCR using the following primers: mE57 forward, 5′-CGCGGATCC-GCCATGCGCTTCAGCTGCCTAGC; mE57 reverse, 5′-TTCCTTTTTTGCGGCCGCTTAGAGGTCCTCTTGTGCCTTCTTCTTCTTCTTAGG. The resulting cDNA was inserted into the pcDNA 3.1/Hygro(+) vector (Invitrogen). With this plasmid as template, the QuikChange II™ site-directed mutagenesis kit (Stratagene) was used to mutate ERp57 residues involved in Cnx or Crt binding and also residues in the -CGHC-active sites. The following primers were used to convert the indicated ERp57 residues to alanine (numbering includes signal sequence); mutagenic bases are shown in lowercase type: R282A, forward (5′-TCTAACTACTGGAGAAACgctGTCATGATGGTGGCAAAGAAATTCC) and reverse (5′-GGAATTTCTTTGCCACCATCATGACagcGTTTCTCCAGTAGTTAGA); K214A, forward (5′-CGTCCATTACATCTTGCTAACgcgTTTGAAGACAAAACTGTGGC) and reverse (5′-GCCACAGTTTTGTCTTCAAAcgcGTTAGCAAGATGTAATGGACG); C406A/C409A, forward (5′-TGAATTTTACGCCCCTTGGgctGGCCACgctAAGAATCTGGAACCCAAG) and reverse (5′-CTTGGGTTCCAGATTCTTagcGTGGCCagcCCAAGGGGCGTAAAATTA); C60A, forward (5′-CCCTGGTGTGGACATgccAAGAGGCTTGCCCC) and reverse (5′-GGGGCAAGCCTCTTggcATGTCCACACCAGGG). C60A/C406A/C409A was made using C60A primers and C406A/C409A as template. Wild type and mutant ERp57 cDNAs were then amplified and subcloned into the retroviral vector pQCXIH (Clontech, Mountain View, CA) using the following primers, which also introduced the NotI and BamHI restriction sites (underlined): forward, 5′-CCGAGCGCGGCCGCGCCATGCGCTTCAGCTGCCTAGC; reverse, 5′-TCGAGCGGATCCTTAGAGGTCCTCTTGTGCCTTCTTCTTC. Three micrograms of each Moloney virus vector, pVPack-GP, pVPack-VSV-G (Stratagene, La Jolla, CA), and pQCXIH containing the desired ERp57 cDNA construct, were diluted in 625 μl of Opti-MEM I reduced serum medium (Invitrogen). The DNA mixture was mixed with 22.5 μl of Lipofectamine 2000 (Invitrogen) prediluted in 625 μl of Opti-MEM I and incubated for 20 min at room temperature. The HEK293 packaging cell line was seeded at 1.4 × 106 cells/T25 flask in complete DMEM 18 h before transfection. The medium was exchanged for 2.5 ml of fresh DMEM without antibiotics, and then the DNA-Lipofectamine 2000 complex was added. After 4 h of transfection, the medium was replaced with 4 ml of fresh medium. The virus supernatant was collected 48 h post-transfection and filtered through a 0.22-μm filter before infecting target cells. Target cells, 4 × 105 ERp57-/- mouse embryonic fibroblasts, were infected in T25 flasks using 4 ml of undiluted virus supernatant in combination with 8 μg/ml Polybrene (Sigma). After 48 h of infection, cells were selected with 300 μg/ml hygromycin B for 3 days and 500 μg/ml hygromycin B for the following days. After 10 days to 1 month under selection, wild type and mutant ERp57 expression levels were obtained that were comparable with that observed in ERp57+/+ cells as assessed by immunoblotting with anti-ERp57 antiserum. ERp57+/+ and ERp57-/- cells infected with virus containing an empty pQCXIH vector were used as control cell lines. To generate the ΔTip2 mutant of mouse Crt that possesses a truncated arm domain (amino acids 223-286 deleted), an overlap extension PCR (26Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene. 1989; 77: 51-59Crossref PubMed Scopus (6851) Google Scholar) was performed. In the first round of PCR, mouse Crt cDNA in pcDNA3.1 (24Ireland B.S. Brockmeier U. Howe C.M. Elliott T. Williams D.B. Mol. Biol. Cell. 2008; 19: 2413-2423Crossref PubMed Scopus (51) Google Scholar) was used as the template to amplify a 699-bp and a 419-bp DNA fragment with the primer pairs (mutagenic bases in lowercase type; restriction sites underlined) NotI-mCrt-forward (5′-ATATGCGGCCGCGCCACCATGCTCCTTTCGGTGCCGCTCCTGCT and mCrt-tip2-reverse (5′-AGGTACCgccactgccTCGTTCATCCCAGTCTTC) and mCrt-tip2-forward (5′-TGAACGAggcagtggcGGTACCTGGATACACCCAG) and BamHI-Crt-reverse (5′-ATATATGGATCCCTAGAGCTCATCCTTGGCTTGGCCAGGGGATTCT), respectively. After purification, the synthesized DNA fragments were used in equimolar amounts as the template in a second PCR to amplify the complete construct using the primer pair NotI-mCrt-forward/BamHI-Crt-reverse. The mutagenic PCR primers introduced a GSG linker at the site of truncation. All final PCR products were digested with NotI and BamHI and ligated into the retroviral expression vector pQCXIH (Clontech). To generate the ERp57 binding-deficient mutant of mouse Crt (D258N), a modified QuikChange™ protocol was performed (27Zheng L. Baumann U. Reymond J.L. Nucleic Acids Res. 2004; 32: e115Crossref PubMed Scopus (848) Google Scholar) using the primer pair mCrt-D258N-forward (5′-GAAGAGATGaatGGAGAGTGGGAACCAC) and mCrt-D258N-reverse (5′-CACTCTCCattCATCTCTTCATCCCAGTC) with mouse Crt cDNA in pcDNA3.1 as the template. The resulting plasmid pcDNA3.1-mCrtD258N was used as a template in a standard PCR with the primer pair NotI-mCrt-forward and BamHI-mCrt-reverse to introduce NotI and BamHI restriction sites into the cDNA for subcloning into the retroviral expression vector pQCXIH. Stable cell lines expressing the Crt-ΔTip2 and Crt-D258N mutants were prepared by infecting Crt-deficient K42 cells with recombinant Moloney viruses packaged with the respective pQCXIH plasmids as described above. Stable transformants were selected in 100 μg/ml hygromycin B. For the HAΔEB mutant, we used a template plasmid provided by Drs. Lars Ellgaard and Eva Frickel (University of Copenhagen) encoding Crt in which the EDWDEEMD sequence of the arm domain was substituted with the SWWKELMH sequence of Saccharomyces cerevisiae Cnx and which also incorporated an influenza hemagglutinin (HA) tag prior to the COOH-terminal KDEL sequence. The Crt insert was amplified by PCR using the primers 5′-CCACTCGAGGCCACCATGCTCCTTTCGGTGCCG (forward) and 5′-GTTCGGTTCCTACTCGACATCCAATTGTGG (reverse), which introduced XhoI and HincII restriction sites, respectively. The PCR product was digested with XhoI and HincII, subcloned into the Moloney murine leukemia virus vector CMV-bipep-ΔNGFR (28Tolstrup A.B. Duch M. Dalum I. Pedersen F.S. Mouritsen S. Gene (Amst.). 2001; 263: 77-84Crossref PubMed Scopus (12) Google Scholar), and transfected into Phoenix cells (ATCC, Manassas, VA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions (1 μg of DNA). On day 3, the cell culture medium containing retroviral particles was used to transduce Crt-deficient K42 cells. Cells were then cloned by limiting dilution. Protein Expression, Preparation, and Purification-The arm domain of mouse Crt (residues 206-278; numbering including signal sequence) of mouse Crt was cloned into the pET15b plasmid (Amersham Biosciences) with an NH2-terminal His6 tag and expressed in Escherichia coli BL21 (DE3) cells. For NMR experiments, the recombinant protein was labeled by growth of E. coli BL21 in M9 minimal medium with 15N-labeled ammonium chloride as the sole source of nitrogen. Cells were harvested and broken in 50 mm HEPES (pH 7.4), 300 mm NaCl, 1 mm β-mercaptoethanol, 5% glycerol. The fusion protein was purified by affinity chromatography on Ni2+-chelating Sepharose resin, and the tag was removed by overnight cleavage with thrombin, leaving a Gly-Ser-His-Met NH2-terminal extension while dialyzing the protein into 20 mm Tris (pH 8.0). The cleaved protein was additionally purified using anion exchange chromatography with a gradient of 0-1.0 m NaCl and exchanged into NMR buffer (20 mm MES, 50 mm NaCl, pH 6.5) using a Centricon 3000 concentrator. cDNAs encoding wild type Crt, the D317A and ΔTip2 mutants, and the D258N mutant of the Crt arm domain (residues 206-305) were cloned into a modified pET15b vector with a tobacco etch virus cleavage site and purified similarly with the exception that the His tag was not cleaved prior to NMR experiments. The wild type and the R282A mutant of the bb′ fragment of human ERp57 were expressed and purified as described earlier (29Kozlov G. Maattanen P. Schrag J.D. Pollock S. Cygler M. Nagar B. Thomas D.Y. Gehring K. Structure. 2006; 14: 1331-1339Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). NMR Spectroscopy-NMR stock solutions contained 0.2-0.3 mm protein in 20 mm MES, 50 mm NaCl at pH 6.5. For NMR titrations, unlabeled bb′ fragments of ERp57 were added to 15N-labeled 0.2 mm wild type or the D258N mutant of Crt arm domain to a final molar ratio of 1:1. All NMR experiments were performed at 30 °C using a Bruker 600-MHz spectrometer equipped with a cryoprobe. NMR spectra were processed using XWINNMR and analyzed with XEASY (30Bartels c. Xia T.H. Billeter M. Güntert P. Wüthrich K. J. Biomol. NMR. 1995; 6: 1-10Crossref PubMed Scopus (1607) Google Scholar). RNA Interference and Transfection-Knockdown of mouse ERp57 by RNA interference was performed as described previously (12Zhang Y. Baig E. Williams D.B. J. Biol. Chem. 2006; 281: 14622-14631Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Double-stranded small interfering RNA (siRNA) corresponding to mouse Cnx DNA sequence AATGTGGTGGTGCCTATGTGA was synthesized and annealed by Qiagen (Valencia, CA). Eighteen hours before transfection, 1 × 105 K41 cells were seeded into 35-mm plates. Cells were then incubated with 80 nm siRNA or control siRNA plus Oligofectamine transfection reagent (Invitrogen) according to the manufacturer's protocol for 4 days before analysis. For all RNA interference experiments, ∼1 × 105 siRNA-transfected cells were used to assess the efficiency of protein depletion by Western blot. Western Blotting Analysis-Cells were solubilized in Nonidet P-40 lysis buffer consisting of PBS, 1% Nonidet P-40, 20 mm N-ethylmaleimide (NEM; Sigma), and protease inhibitors (60 μg/ml 2-aminoethyl-benzenesulfonylfluoride and 10 μg/ml each leupeptin, antipain, and pepstatin (BioShop, Burlington, Canada)). Following centrifugation at 10,000 × g to remove nuclei and cell debris, the supernatant fractions were separated by SDS-PAGE (10% gel) before transfer to Immobilon membrane (Millipore) in buffer containing 25 mm Tris and 0.7 m glycine. Membranes were probed with various rabbit antisera followed by horseradish peroxidase-conjugated goat anti-rabbit secondary antibody. Proteins were detected by enhanced chemiluminescence, films were scanned using an EPSON 1680 scanner, and individual bands were quantified with NIH Image software (National Institutes of Health). In all cases, background values obtained by quantifying a blank area of the film corresponding in size to that of the gel band of interest were subtracted. Metabolic Radiolabeling and Immunoisolation-All pulsechase radiolabeling experiments were conducted on 5 × 105 cells growing in 35-mm plates. Cells were starved for 30 min with Met-free RPMI 1640 and then radiolabeled for 2 min with 0.5 ml of medium containing 0.1 mCi of [35S]Met (>1000 Ci/mmol; Amersham Biosciences). Cells were then washed with Met-free RPMI 1640 and chased for various periods in DMEM containing 1 mm Met and 500 μm cycloheximide. Cells were placed on ice and treated for 3 min with 20 mm NEM in ice-cold PBS, pH 6.8, to minimize disulfide bond rearrangements. Lysis was conducted in 500 μl of Nonidet P-40 lysis buffer, and following centrifugation at 10,000 × g, the supernatant fraction was incubated on ice for 2 h with anti-8 antiserum or mAb 34-2-12S to isolate H-2Kb or H-2Dd, respectively. Immune complexes were recovered by shaking for 1 h with 30 μl of packed protein A-agarose beads. The beads were washed four times in 10 mm Tris, 0.5% Nonidet P-40, 150 mm NaCl, 0.02% NaN3, pH 7.4, and then isolated molecules were eluted by boiling for 5 min in SDS-PAGE sample buffer with or without dithiothreitol (DTT) as a reducing agent. Samples were analyzed by SDS-PAGE (10% gel) followed by fluorography. Films were scanned, and protein bands were quantified as described above. To test for interaction between Crt and various ERp57 constructs, 1 × 107 nonradiolabeled cells were collected and washed once with PBS before lysing the cells in digitonin lysis buffer (PBS containing 1% digitonin, 20 mm NEM, and protease inhibitor mixture). Crt was purified from postnuclear lysates using protein G beads precoated with mouse anti-Crt mAb. Samples were washed twice in PBS containing 0.2% digitonin, and isolated molecules were separated on SDS-PAGE and transferred to Immobilon membranes (Millipore) for immunoblotting with anti-ERp57 Ab. To examine the composition of the PLC, anti-tapasin antiserum, which was raised against a peptide corresponding to the carboxyl-terminal 20 amino acids of murine tapasin, was used to immunoisolate the PLC from digitonin cell lysates. Following collection of immune complexes on protein A-agarose, the PLC was eluted using a 100 μm concentration of the tapasin carboxyl-terminal peptide. This minimized elution of rabbit immunoglobulins from the beads, which would be detected in subsequent immunoblotting steps employing rabbit antisera directed against PLC components. Flow Cytometry-To determine the cell surface levels of class I molecules, 3-5 × 105 cells were removed from culture plates by trypsinization and incubated on ice for 20 min in 100 μl of culture medium containing 1.5 μg of either mAb Y3 for Kb or mAb B22.249 R1 for Db. After incubation, cells were washed once with fluorescence-activated cell sorting buffer (Hanks' balanced salt solution, 1% bovine serum albumin, and 0.01% NaN3) and then incubated on ice for 20 min with 0.4 μg of phycoerythrin-conjugated goat anti-mouse IgG (H + L chain-specific; Cedarlane, Burlington, Canada) in 100 μl of fluorescence-activated cell sorting buffer. Cells were washed twice with fluorescence-activated cell sorting buffer and then fixed in 0.5% paraformaldehyde in PBS, pH 7.4. Subsequent flow cytometry was performed using a BD FACSCalibur Flow Cytometer (BD Biosciences). Circular Dichroism Measurements-Wild type Crt and the D317A and ΔTip2 mutant proteins (10 μm) were incubated for 1 h at room temperature in 150 μl of 20 mm Hepes, pH 7.4, 150 mm NaCl, 1 mm CaCl2 in the presence or absence of 100 μm Glcα3Manα2Manα2Man-OH oligosaccharide (Alberta Research Council, Edmonton, Alberta). Thermal denaturation was measured in a 1-mm path length cuvette by recording the change in ellipticity at 228 nm in the temperature range 26-60 °C with a scan rate of 2 °C/min using a Jasco 810 spectropolarimeter. The recorded ellipticities were normalized to obtain the mean residue molar ellipticity ([θ](λ)) in degrees/cm2/dmol according to the equation, [Θ](λ)=Θ(λ)c·n·l where l represents the path length of the cuvette in centimeters, θ(λ) is the recorded ellipticity in degrees at wavelength λ, c is the concentration in mol/liter, and n is the number of amino acid residues (422 for wild type Crt and D317A Crt and 361 for ΔTip2 Crt). Three independent denaturation curves were averaged under each condition. To
Abstract Necrotizing enterocolitis (NEC) is a devastating neonatal disease characterized by acute intestinal injury. Intestinal stem cell (ISC) renewal is required for gut regeneration in response to acute injury. The Wnt/β-catenin pathway is essential for intestinal renewal and ISC maintenance. We found that ISC expression, Wnt activity and intestinal regeneration were all decreased in both mice with experimental NEC and in infants with acute active NEC. Moreover, intestinal organoids derived from NEC-injured intestine of both mice and humans failed to maintain proliferation and presented more differentiation. Administration of Wnt7b reversed these changes and promoted growth of intestinal organoids. Additionally, administration of exogenous Wnt7b rescued intestinal injury, restored ISC, and reestablished intestinal epithelial homeostasis in mice with NEC. Our findings demonstrate that during NEC, Wnt/β-catenin signaling is decreased, ISC activity is impaired, and intestinal regeneration is defective. Administration of Wnt resulted in the maintenance of intestinal epithelial homeostasis and avoidance of NEC intestinal injury.
Repository information:16S_metadata.txt - describes 16S rRNA gene sequence files16S_OTU_table_closedReference_singletonFiltered_sd4800.biom - OTU table for 16S rRNA gene sequence analysis after removing open-reference OTUs and singletons and rarefaction to 4,800 OTU counts/sample
Maternal separation (MS) in neonates can lead to intestinal injury. MS in neonatal mice disrupts mucosal morphology, induces colonic inflammation and increases trans-cellular permeability. Several studies indicate that intestinal epithelial stem cells are capable of initiating gut repair in a variety of injury models but have not been reported in MS. The pathophysiology of MS-induced gut injury and subsequent repair remains unclear, but communication between the brain and gut contribute to MS-induced colonic injury. Corticotropin-releasing hormone (CRH) is one of the mediators involved in the brain-gut axis response to MS-induced damage. We investigated the roles of the CRH receptors, CRHR1 and CRHR2, in MS-induced intestinal injury and subsequent repair. To distinguish their specific roles in mucosal injury, we selectively blocked CRHR1 and CRHR2 with pharmacological antagonists. Our results show that in response to MS, CRHR1 mediates gut injury by promoting intestinal inflammation, increasing gut permeability, altering intestinal morphology, and modulating the intestinal microbiota. In contrast, CRHR2 activates intestinal stem cells and is important for gut repair. Thus, selectively blocking CRHR1 and promoting CRHR2 activity could prevent the development of intestinal injuries and enhance repair in the neonatal period when there is increased risk of intestinal injury such as necrotizing enterocolitis.
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)