I. A. Selezneva

Samara State Medical University

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Trends

Author Order

Document Type

Co-Authors

ТВ

Т. В. Синкина

Russian Cancer Research Center NN Blokhin

ВД

В. Д. Петрова

Altai State Medical University

МЛ

М. Л. Филипенко

Institute of Chemical Biology and Fundamental Medicine

СА

С. А. Терехова

Volgograd State Pedagogical University

F. N. Gilmiyarova

Ministry of Health of the Russian Federation

O. A. Gusyakova

Samara State Medical University

АФ

А. Ф. Лазарев

Yuri Gagarin State Technical University of Saratov

U. A. Boyarskikh

Institute of Chemical Biology and Fundamental Medicine

АФ

А. Ф. Лазарев

Altai State Medical University

I. A. Borodina

Samara State Medical University

Cooperative Institutions

Samara State Medical University

Ministry of Health of the Russian Federation

Russian Academy of Sciences

Institute of Chemical Biology and Fundamental Medicine

Siberian Branch of the Russian Academy of Sciences

Academy of Medical Sciences

Russian Cancer Research Center NN Blokhin

Novosibirsk State University

Peoples' Friendship University of Russia

Altai State Medical University

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Field

HEMATOSALIVARIAN BARRIER: STRUCTURE, FUNCTIONS, STUDY METHODS (REVIEW OF LITERATURE)

Russian Clinical Laboratory Diagnostics (2022)

I. A. Selezneva F. N. Gilmiyarova В. С. Тлустенко D A Domenjuk O. A. Gusyakova

The human body consists of various systems (blood, tissues, extracellular fluid, intracellular contents) separated by biological membranes. Physiological barriers ensure the physico-chemical composition of the internal environment remains constant and protects the body from environmental changes. The permeability of the histohematic barrier depends on the concentration of substances in the blood, the body's condition, external influences, and a number of other reasons caused by stimuli coming from the external or internal environment. Information about the state of the regulatory systems of the body has its effect on specific chemoreceptors, which leads to the emergence of local and general physiological and biochemical processes. According to their localization, they distinguish between the hematoencephalic, hemato-placental, hemato-ophthalmic, and hemato-salivary barriers. Recently, the hematosalivary barrier, through which the selective entry of substances from the blood into the oral fluid is carried out, has taken a special place in the study. Its functioning depends on the processes occurring in the body, which is carried out by selective permeability for substances that determine the composition of the main internal environment of the body - blood. Hematosalivary barrier is an important link in maintaining homeostasis, which is reflected in the metabolic parameters of oral fluid.

Homeostasis

Body fluid

Fluid compartments

Intracellular Fluid

10.51620/0869-2084-2022-67-6-334-338

Cite

Citations (3)

Metabolic profile of blast cells in acute myeloid leukemia. Literature review

Oncohematology (2024)

A. V. Khaliulin Irene Zanin А. V. Lyamin И. Л. Давыдкин I. A. Selezneva

The article presents a review of new data on blast cells metabolism and its regulatory mechanisms in acute myeloid leukemia. Particular attention is given to the role of reactive oxygen species in the regulation of signaling pathways and metabolic processes, as well as their influence on the aggressiveness and resistance to chemotherapeutic agents in acute myeloid leukemia. Elevated levels of reactive oxygen species are associated with altered activity of enzymes and proteins involved in cell proliferation and survival. The article also discusses data on the iron role in the formation of malignancy in acute myeloid leukemia.

10.17650/1818-8346-2024-19-4-173-181

Cite

Citations (0)

Effect of point substitutions in the MnSOD, GPX1, and GSTP1 genes on the risk of familial and sporadic breast cancers in residents of Altai Krai

Russian Journal of Genetics (2010)

Н. А. Ермоленко U. A. Boyarskikh А. Г. Сушко Е. Н. Воронина I. A. Selezneva

GSTP1

Human genetics

10.1134/s1022795410120124

Cite

Citations (4)

No association between NQO1 polymorphism and breast cancer risk in Siberian population

Journal of Clinical Oncology (2007)

М. Л. Филипенко E. V. Pechkovsky O. V. Mishukova А. Ф. Лазарев В. Д. Петрова

21185 Background: NQO1 is a two-electron reductase, which metabolizes a variety of xenobiotics. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Genetic polymorphism of NQO1 is a C to T point mutation at base pair 609 of exon 6, which codes for a proline to serine substitution in NQO1 protein. This mutation results in a loss of NQO1 activity. Previously it was reported that wild-type NQO1 increased lung adenocarcinoma risk among male smokers in Taiwan. The association of the P187S polymorphism with breast cancer found in study of two independent populations (one from Tyrol, Austria, and the other from Prague, Czech Republic) (Menzel et al., 2004). Methods: The purpose of this study was to determine whether polymorphism in the NQO1 gene may influence breast cancer risk in Siberian population. The prevalent case-control design was used. The cases were 203 patients with breast cancer. Controls consisted of 182 noncancer outpatients. Genotyping for detecting of NQO1 gene polymorphism was performed using PCR amplification with the primer set of 5'- ACGCTAGCTCTGAACTGATTCTCT -3' and 5'- TTTTCTCCTCATCCTGTACCTCT –3’. The amplified PCR products were digested with HinfI and analyzed using electrophoresis on a 2.5% agarose gel. Results: Compared to subjects having C alleles (genotype CC), odds ratio (chi2=0.04, p=0.84309) were 1.116 (0.376–3.311) for subjects having genotype TT. Conclusions: These results suggest that polymorphic variation P187S of the NQO1 gene has no influence on breast cancer risk in Siberian women. No significant financial relationships to disclose.

10.1200/jco.2007.25.18_suppl.21185

Cite

Citations (0)

Newborns from women infected with COVID-19: somatic and metabolic status

Russian Clinical Laboratory Diagnostics (2021)

I. A. Borodina F. N. Gilmiyarova O. A. Gusyakova I. A. Selezneva О. В. Борисова

To date, there are limited data regarding manifestations of new coronavirus infection in infants born of SARS-CoV-2 infected mothers, so the aim of this study is to investigate somatic and metabolic status of newborn infants born to mothers diagnosed with COVID-19. The investigation was carried out on the bases of Laboratory Diagnostic Department of Samara Regional Clinical Hospital named after V.D. Seredavin and the Department of Fundamental and Clinical Biochemistry with Laboratory Diagnostics of Samara State Medical University. Under observation were 85 newborns, including 35 born of healthy mothers and 50 born of COVID-19 mothers.The somatic status of all newborns was assessed using the Apgar scale at the 1st and 5th minutes after birth. Also all newborns had general and biochemical blood tests and newborns from mothers with COVID-19 were tested for the presence of SARS-CoV-2 RNA in oral and nasopharyngeal swabs. Thus, the study of somatic status revealed that of 50 neonates from women infected with COVID-19, only 18% were practically healthy, the rest had signs of prematurity, hypotrophy, perinatal CNS damage, diabetic fetopathy, pulmonary atelectasis, delayed intrauterine development, asphyxia. The metabolic state is characterised by decreased haemoglobin and platelets, increased concentration of total protein, including C-reactive protein, high transaminase activity, decreased sodium and chloride content. These parameters of general and biochemical blood tests can be considered as indicators for the evaluation of the condition of newborns from mothers with COVID-19.

10.51620/0869-2084-2021-66-8-453-458

Cite

Citations (1)

Factor analysis in early detection of malignancies

Journal of Clinical Oncology (2006)

А. Ф. Лазарев В. Д. Петрова Т. В. Синкина I. A. Selezneva С. А. Терехова

1033 Background: The existing methods of forecasting of malignancies and forming o of increased oncological risk groups are unserviceable for practical use because of their low reliability (no more than 84%). Methods: There was elaborated an original method for forming of increased oncological risk groups with reliability of 95%. It is based on factor analysis, including the data of phenotypes and genotypes, anamnesis, laboratory testing with further computer processing. The result lies in determination of a factor number. Its quantity forms figures of oncological risk rate. The dependence of risk rate on the quantity of a factor number is ascertained on the basis of data of more than 10000 observations ( table ). The patients with risk rate more than 80–90% are subjected to complex examination according to the elaborated algorithms. In case of absence of clinical symptoms of this or that organ lesion, each-organ search is being made in order to detect malignant neoplasms in accordance with their frequency on the territory of Altai region. Results: There were examined 4775 patients who happened to be in the zone of radioactive influence of Semipalatinsk nuclear testing ground (aged 43 years - 83 years old): male - 1639, female - 3136. 191 (4.0%) cases of cancer were detected: thyroid gland cancer - 56 cases, mammary gland cancer - 23, skin cancer - 49, uterine cervix cancer - 14, stomach cancer -11, lungs cancer -11, others -27. 5 cases of cancer in situ were revealed. Specific gravity of early forms of cancer was 96.5%. Conclusion: The research proved high effectiveness of the elaborated method for increased oncological risk group formation. [Table: see text] No significant financial relationships to disclose.

Anamnesis

10.1200/jco.2006.24.18_suppl.1033

Cite

Citations (3)

1235 POSTER Discriminatory analysis in determination of high risk of gastric cancer

European Journal of Cancer Supplements (2007)

С. А. Терехова А. Ф. Лазарев Veneta Petrova Т. В. Синкина I. A. Selezneva

Echinococcus

Echinococcus multilocularis

Alveolar echinococcosis

10.1016/s1359-6349(07)70716-4

Cite

Citations (0)

Polymorphic variants of folate metabolizing genes (C677T and A1298C MTHFR and C1420T SHMT1 and G1958A MTHFD) are not associated with the risk of breast cancer in the West Siberian Region of Russia

Molecular Biology (2010)

Alexandra S. Weiner U. А. Boyarskih Е. Н. Воронина I. A. Selezneva Т. В. Синкина

10.1134/s0026893310050067

Cite

Citations (33)

Полиморфизм генов синтеза и метаболизма эстрогенов и риск рака молочной железы

Клиническая лабораторная диагностика (2014)

E. V. Pechkovskii Шадрина Александра Сергеевна У А Боярских I. A. Selezneva Т. В. Синкина

The genetic polymorphism of enzymes of synthesis and metabolism of estrogens can input into predisposition to breast cancer. The purpose of actual study was to analyze the associations of polymorphic loci CYP171B1rs10556836, CYP1A1rs1048943, CYP1A2rs762551, CYP19A1rs2470152 and CYP17A1rs743572 with risk of development of breast cancer in Russian residents of the Western-Siberian region of Russia. The rates of alleles and genotypes of the given loci were determined in sampling of women suffering with breast cancer (n=670 females) and in control group (480 females without oncological diseases). The sub-groups of patients with breast cancer in pre-menopause and postmenopause were analyzed separately. The border-line association of locus CYP17A1rs743572 is demonstrated with increasing of risk of breast cancer during pre-menopause (allele C: p=0.04). Among the rest of polymorphic loci no association was detected.

Source

Cite

Citations (0)

Algorithm of monitoring of patients with family history of cancer as a method of cancer prevention

Journal of Clinical Oncology (2007)

В. Д. Петрова Т. В. Синкина Н А Зарубина С. А. Терехова J. N. Dimitriadi

1542 Background: Existent genetic tests are not able to provide effective forecasting of all cancer sites and all those methods are generally expensive. At the same time approximately 50% of population has cancer susceptibility and 10% - hereditary cancer syndromes. The purpose of this study was to develop the algorithm of monitoring to provide effective forecasting and prevention of cancer in patients with hereditary cancer susceptibility. Methods: The algorithm of monitoring of patients with family history of cancer includes 2 stage: I - diagnostic, II - treatment and rehabilitation. In the I stage patients with 3 and more relatives by blood who had cancers of any site are revealed by oncologist. Their genealogical trees are analyzed by geneticist. All those patients are registered in the registry of “cancer”-families’ members, interviewed and got all the necessary diagnostic procedures with the following multivariative analysis (of more than 200 geno- and phenotypic characteristics). Patients with determined high risk of malignancies undergo deep clinical and instrumental examination, site-by-site searching for cancer, molecular genetic tests. In the II stage individual recommendations for the patients are developed, pretumour lesions are treated, preventative surgery is performed (resection of a target organ) and the measures for strengthening of anti-tumour resistance are taken. All the patients of the registry get the periodic health examination for term of life: preventive examination once per 6 months, multivariative analysis once per 3 years. Results: The registry of “cancer”-families’ members included 421 families - 1833 patients (232 men and 1601 women at the age of 28–74). In 2003–2006 there were revealed obligatory pre-cancer lesions in 637 patients, cancers in situ - in 45 patients, and cancers of different sites - in 69 patients (in I stage - 78.3%, II stage - 18.9%, III stage - 2.8%, IV stage - 0). Conclusions: This algorithm of monitoring of the patients from the registry of “cancer”-families’ members made it possible to provide high effectiveness of cancer prevention and early detection. No significant financial relationships to disclose.

Geneticist

Cancer Prevention

10.1200/jco.2007.25.18_suppl.1542

Cite

Citations (2)