Abstract The decreasing efficacy of antiviral drugs due to viral mutations highlights the challenge of developing a single agent targeting multiple strains. Using host cell viral receptors as competitive inhibitors is promising, but their low potency and membrane‐bound nature have limited this strategy. In this study, the authors show that angiotensin‐converting enzyme 2 (ACE2) in a planar membrane patch can effectively neutralize all tested severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) variants that emerged during the COVID‐19 pandemic. The ACE2‐incorporated membrane patch implemented using nanodiscs replicated the spike‐mediated membrane fusion process outside the host cell, resulting in virus lysis, extracellular RNA release, and potent antiviral activity. While neutralizing antibodies became ineffective as the SARS‐CoV‐2 evolved to better penetrate host cells the ACE2‐incorporated nanodiscs became more potent, highlighting the advantages of using receptor‐incorporated nanodiscs for antiviral purposes. ACE2‐incorporated immunodisc, an Fc fusion nanodisc developed in this study, completely protected humanized mice infected with SARS‐CoV‐2 after prolonged retention in the airways. This study demonstrates that the incorporation of viral receptors into immunodisc transforms the entry gate into a potent virucide for all current and future variants, a concept that can be extended to different viruses.
Many antibody-based antivirals, including broadly neutralizing antibodies (bnAbs) against various influenza virus strains, suffer from limited potency. A booster of the antiviral activity of an antibody is expected to facilitate development of antiviral therapeutics. In this study, a nanodisc (ND), a discoidal lipid bilayer encircled by membrane scaffold proteins, is engineered to provide virucidal properties to antibodies, thereby augmenting their antiviral activity. NDs carrying the Fc-binding peptide sequence form an antibody-ND complex (ANC), which can co-endocytose into cells infected with influenza virus. ANC efficiently inhibits endosome escape of viral RNA by dual complimentary mode of action. While the antibody moiety in an ANC inhibits hemagglutinin-mediated membrane fusion, its ND moiety destroys the viral envelope using free hemagglutinins that are not captured by antibodies. Providing virus-infected host cells with the ability to self-eliminate by the synergistic effect of ANC components dramatically amplifies the antiviral efficacy of a bnAb against influenza virus. When the efficacy of ANC is assessed in mouse models, administration of ANCs dramatically reduces morbidity and mortality compared to bnAb alone. This study is the first to demonstrate the novel nanoparticle ANC and its role in combating viral infections, suggesting that ANC is a versatile platform applicable to various viruses.
The tumor-associated glycoprotein (TAG)-72 is expressed in the majority of human adenocarcinomas but is rarely expressed in most normal tissues, which makes it a potential target for the diagnosis and therapy of a variety of human cancers. Here we describe the construction, affinity maturation, and biological characterization of an anti-TAG-72 humanized antibody with minimum potential immunogenicity. The humanized antibody was constructed by grafting only the specificity-determining residues (SDRs) within the complementarity-determining regions (CDRs) onto homologous human immunoglobulin germ line segments while retaining two mouse heavy chain framework residues that support the conformation of the CDRs. The resulting humanized antibody (AKA) showed only about 2-fold lower affinity compared with the original murine monoclonal antibody CC49 and 27-fold lower reactivity to patient serum compared with the humanized antibody HuCC49 that was constructed by CDR grafting. The affinity of AKA was improved by random mutagenesis of the heavy chain CDR3 (HCDR3). The highest affinity variant (3E8) showed 22-fold higher affinity compared with AKA and retained the original epitope specificity. Mutational analysis of the HCDR3 residues revealed that the replacement of Asn97 by isoleucine or valine was critical for the affinity maturation. The 3E8 labeled with 125I or 131I showed efficient tumor targeting or therapeutic effects, respectively, in athymic mice with human colon carcinoma xenografts, suggesting that 3E8 may be beneficial for the diagnosis and therapy of tumors expressing TAG-72. The tumor-associated glycoprotein (TAG)-72 is expressed in the majority of human adenocarcinomas but is rarely expressed in most normal tissues, which makes it a potential target for the diagnosis and therapy of a variety of human cancers. Here we describe the construction, affinity maturation, and biological characterization of an anti-TAG-72 humanized antibody with minimum potential immunogenicity. The humanized antibody was constructed by grafting only the specificity-determining residues (SDRs) within the complementarity-determining regions (CDRs) onto homologous human immunoglobulin germ line segments while retaining two mouse heavy chain framework residues that support the conformation of the CDRs. The resulting humanized antibody (AKA) showed only about 2-fold lower affinity compared with the original murine monoclonal antibody CC49 and 27-fold lower reactivity to patient serum compared with the humanized antibody HuCC49 that was constructed by CDR grafting. The affinity of AKA was improved by random mutagenesis of the heavy chain CDR3 (HCDR3). The highest affinity variant (3E8) showed 22-fold higher affinity compared with AKA and retained the original epitope specificity. Mutational analysis of the HCDR3 residues revealed that the replacement of Asn97 by isoleucine or valine was critical for the affinity maturation. The 3E8 labeled with 125I or 131I showed efficient tumor targeting or therapeutic effects, respectively, in athymic mice with human colon carcinoma xenografts, suggesting that 3E8 may be beneficial for the diagnosis and therapy of tumors expressing TAG-72. Monoclonal antibodies (mAbs) 4The abbreviations used are: mAb, monoclonal antibody; TAG-72, tumor-associated glycoprotein-72; SDR, specificity-determining residue; CDR, complementarity-determining region; HCDR, heavy chain CDR; FR, framework region; LCDR, light chain CDR; VH, heavy chain variable domain; VL, light chain variable domain; JH, heavy chain joining region; JK, κ light chain joining region; Cκ, κ light chain constant region; Cγ, γ heavy chain constant region; CHO, Chinese hamster ovary; ELISA, enzyme-linked immunosorbent assay; Fab, antigen-binding fragment.4The abbreviations used are: mAb, monoclonal antibody; TAG-72, tumor-associated glycoprotein-72; SDR, specificity-determining residue; CDR, complementarity-determining region; HCDR, heavy chain CDR; FR, framework region; LCDR, light chain CDR; VH, heavy chain variable domain; VL, light chain variable domain; JH, heavy chain joining region; JK, κ light chain joining region; Cκ, κ light chain constant region; Cγ, γ heavy chain constant region; CHO, Chinese hamster ovary; ELISA, enzyme-linked immunosorbent assay; Fab, antigen-binding fragment. are increasingly being used as therapeutic agents for cancer and other diseases. Murine mAbs have limited use as therapeutic agents because of a short half-life, an inability to trigger human effector functions, and the induction of a human anti-mouse antibody response (1Seccamani E. Tattanelli M. Mariani M. Spranzi E. Scassellati G.A. Siccardi A.G. Int. J. Rad. Appl. Instrum. B. 1989; 16: 167-170Abstract Full Text PDF PubMed Scopus (66) Google Scholar, 2Colcher D. Milenic D.E. Ferroni P. Carrasquillo J.A. Reynolds J.C. Roselli M. Larson S.M. Schlom J. J. Nucl. Med. 1990; 31: 1133-1142PubMed Google Scholar). To reduce the immunogenicity of murine antibodies in humans, chimeric antibodies with mouse variable regions and human constant regions were initially constructed (3Morrison S.L. Johnson M.J. Herzenberg L.A. Oi V.T. Proc. Nat1 Acad. Sci. U. S. A. 1984; 21: 6851-6855Crossref Scopus (800) Google Scholar). Although chimeric antibodies proved to be less immunogenic than murine mAbs, human anti-chimeric antibody responses have been observed (4Bell M. Kamm M. Aliment Pharmacol. Ther. 2000; 14: 501-514Crossref PubMed Scopus (67) Google Scholar). To further reduce the immunogenicity of the mouse variable regions, a humanized antibody has been constructed by grafting the complementarity-determining regions (CDRs) of a murine mAb onto the human framework regions (FRs) by a procedure commonly referred to as CDR grafting (5Jones P.T. Dear P.H. Foote J. Neuberger M.S. Winter G. Nature. 1986; 321: 522-525Crossref PubMed Scopus (1101) Google Scholar). Simple grafting CDRs, however, often decreased the affinity, because some FR residues directly contact the antigen or support the conformation of the CDR loops (6Queen C. Schneider W.P. Selick H.E. Payne P.W. Landolfi N.F. Duncan J.F. Avdalovic N.M. Levitt M. Junghans R.P. Waldmann T.A. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 10029-10033Crossref PubMed Scopus (557) Google Scholar, 7Al-Lazikani B. Lesk A.M. Chothia C. J. Mol. Biol. 1997; 273: 927-948Crossref PubMed Scopus (578) Google Scholar). Therefore, humanized antibody is currently constructed primarily by CDR grafting, while retaining those rodent FR residues that influence antigen-binding activity (8Winter G. Harris W.J. Immunol. Today. 1993; 14: 243-246Abstract Full Text PDF PubMed Scopus (143) Google Scholar). Since the FR residues often differ from one humanized antibody to another, the identification of key rodent FR residues is a crucial part of the humanization (9Reichert J.M. Nat. Biotechnol. 2001; 19: 819-822Crossref PubMed Scopus (153) Google Scholar). Clinical studies have indicated that such humanized antibodies are, in general, less immunogenic than murine or chimeric antibodies and are tolerated by humans (10Stephens S. Emtage S. Vetterlein O. Chaplin L. Bebbington C. Nesbitt A. Sopwith M. Athwal D. Novak C. Bodmer M. Immunology. 1995; 85: 668-674PubMed Google Scholar, 11Mateo C. Moreno E. Amour K. Lombardero J. Harris W. Perez R. Immunotechnology. 1997; 3: 71-81Crossref PubMed Scopus (167) Google Scholar). Unfortunately, the non-human CDRs of humanized antibodies can induce human anti-humanized antibody responses in patients (12Hwang W.Y.K. Foote J. Methods. 2005; 36: 3-10Crossref PubMed Scopus (454) Google Scholar). Comprehensive analyses of the three-dimensional structures of the antibody-combining sites have revealed that only 20–33% of the CDR residues participate in antigen-binding (13Glaser S.M. Vasquez M. Payne P.W. Schneider P.W. J. Immunol. 1992; 149: 2607-2614PubMed Google Scholar, 14Padlan E.A. Mol. Immunol. 1994; 31: 169-217Crossref PubMed Scopus (783) Google Scholar, 15Padlan E.A. Abergel C. Tipper J.P. FASEB J. 1995; 9: 133-139Crossref PubMed Scopus (123) Google Scholar). Most of the variable positions of CDRs are directly involved in the interaction with antigen (i.e. specificity-determining residues (SDRs)), whereas most of the conserved residues mainly serve to stabilize the structure of the combining site (15Padlan E.A. Abergel C. Tipper J.P. FASEB J. 1995; 9: 133-139Crossref PubMed Scopus (123) Google Scholar). The SDRs are observed primarily in the C-terminal part of light chain CDR1 (LCDR1), the first and sometimes also the middle positions in LCDR2, the middle portion of LCDR3, most of the heavy chain CDR1 (HCDR1), the N-terminal and middle parts of HCDR2, and most of HCDR3 except the terminal position. The SDRs form the center of the antibody-combining site. Therefore, one possible way to minimize the human anti-humanized antibody response is to graft only the SDRs of a murine antibody onto human FRs while maintaining the conformations of the CDRs of the murine antibody. Tumor-associated glycoprotein (TAG)-72 is expressed by the majority of human adenocarcinomas in the colon, ovary, pancreas, breast, prostate, and lung but not in most normal tissues, except the endometrium in the secretory phase (16Thor A. Ohuchi N. Szpak C.A. Johnston W.W. Schlom J. Cancer Res. 1986; 46: 3118-3124PubMed Google Scholar, 17Thor A. Viglione M.J. Muraro R. Ohuchi N. Schlom J. Gorstein F. Int. J. Gynecol. Pathol. 1987; 6: 235-247Crossref PubMed Scopus (130) Google Scholar). A murine mAb B72.3 (16Thor A. Ohuchi N. Szpak C.A. Johnston W.W. Schlom J. Cancer Res. 1986; 46: 3118-3124PubMed Google Scholar) that specifically binds to TAG-72 is approved for in vivo imaging in patients with ovarian and colorectal cancers. A second generation antibody to B72.3, CC49 (18Muraro R. Kuroki M. Wunderlich D. Poole D.J. Colcher D. Thor A. Greiner J.W. Simpson J.F. Molinolo A. Noguchi P. Schlom J. Cancer Res. 1988; 48: 4588-4596PubMed Google Scholar, 19Colcher D. Minelli F.M. Roselli M. Muraro R. Simpson-Milenic D. Schlom J. Cancer Res. 1988; 48: 4597-4603PubMed Google Scholar), which has higher affinity for TAG-72 than B72.3 does, has shown efficient targeting to various carcinomas in clinical trials (20Divgi C.R. Scott A.M. Gulec S. Broussard E.K. Levy N. Young C. Capitelli P. Daghighian F. Williams J.M. Finn R.D. Clin. Cancer Res. 1995; 1: 1503-1510PubMed Google Scholar, 21Divgi C.R. Scott A.M. McDermott K. Fallone P.S. Hilton S. Siler K. Carmichael N. Daghighian F. Finn R.D. Cohen A.M. Schlom J. Larson S.M. Nucl. Med. Biol. 1994; 21: 9-15Crossref PubMed Scopus (25) Google Scholar, 22Mulligan T. Carrasquillo J.A. Chung Y. Milenic D.E. Schlom J. Feuerstein I. Paik C. Perentesis P. Reynolds J. Curt G. Goeckeler W. Fordyce W. Cheng R. Riseberg D. Cowan K. O'Shaughnessy J. Clin. Cancer Res. 1995; 1: 1447-1454PubMed Google Scholar). The epitope for B72.3 or CC49 has been identified as sialyl-Tn (i.e. α-sialyl 2–6αGalNAc), O-linked to Ser/Thr on mucin-type glycoproteins (23Kjeldsen T. Clausen H. Hirohashi S. Ogawa T. Iijima H. Hakomori S-I. Cancer Res. 1988; 48: 2214-2220PubMed Google Scholar). However, CC49 elicits human anti-mouse antibody responses in patients (24Divgi C.R. Scott A.M. Dantis L. Capitelli P. Siler K. Hilton S. Finn R.D. Kemeny N. Kelsen D. Kostakoglu L. J. Nucl. Med. 1995; 36: 586-592PubMed Google Scholar). To overcome this problem, a humanized CC49 antibody (HuCC49) has been constructed by CDR grafting while retaining the buried FR residues that affect the structure of the antibody and those involved in VL-VH interaction or antigen binding (25Kashmiri S.V.S. Shu L. Padlan E.A. Milenic D.E. Schlom J. Hand P.H. Hybridoma. 1995; 14: 461-473Crossref PubMed Scopus (73) Google Scholar). Subsequently, to reduce the immunogenicity of HuCC49, the mouse CDR and FR residues have been replaced individually with corresponding human residues, and the antigen-binding activity and potential immunogenicity of each variant have been analyzed (26Iwahashi M. Milenic D.E. Padlan E.A. Bei R. Schlom J. Kashmiri S.V.S. Mol. Immunol. 1999; 36: 1079-1091Crossref PubMed Scopus (31) Google Scholar, 27Tamura M. Milenic D.E. Iwahashi M. Padlan E. Schlom J. Kashmiri S.V.S. J. Immunol. 2000; 164: 432-441Crossref Scopus (50) Google Scholar, 28Gonzales N.R. Padlan E.A. De Pascalis R. Schuck P. Schlom J. Kashmiri S.V.S. Mol. Immunol. 2003; 40: 337-349Crossref PubMed Scopus (22) Google Scholar, 29De Pascalis R. Gonzales N.R. Padlan E.A. Schuck P. Batra S.K. Schlom J. Kashmiri S.V.S. Clin. Cancer Res. 2003; 9: 5521-5531PubMed Google Scholar). In the present study, humanized antibody was constructed by grafting only the SDRs onto a human Ig germ line segment with CDRs of the same canonical structures as those of the murine antibody while retaining two key murine FR residues. The resulting humanized antibody AKA showed only about 2-fold lower affinity compared with CC49. Subsequently, antibody affinity was increased by random mutagenesis of HCDR3 residues followed by affinity selection. The resulting humanized antibody (3E8) showed 27-fold lower sera reactivity compared with HuCC49 and higher affinity compared with original CC49. The antibody showed specific tumor targeting and anti-tumor therapeutic effects in athymic mice bearing human adenocarcinoma xenografts expressing TAG-72. Construction of Humanized Antibody—To select human FRs for SDR grafting, the VH and VL sequences of CC49 were compared with those of human Ig variable and joining region germ line segments. It was found that DP25-JH4 and DPK24-JK4 were the most homologous to the VH and VL of CC49, respectively (Fig. 1). To construct the VL of the humanized light chain (HzK), only Tyr94 in the LCDR3 of CC49 was grafted onto human DPK24-JK4 (Fig. 1A). The numbering follows Kabat et al. (30Kabat E.A. Wu T.T. Perry H.M. Gottesman K.S. Foeller C. Sequences of Proteins of Immunological Interest. 5th. NIH Publication 91-3242, U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, MD1991: 103-511Google Scholar). The VL sequence of HzK was synthesized by recombinant PCR using a humanized VL (pCLS2-hygro) (31Park S.S. Nam K.-Y. No K.T. Ryu C.J. Gripon P. Guguen-Guillouzo C. Hong H.J. Hybridoma. 1996; 15: 435-441Crossref PubMed Scopus (16) Google Scholar), which is also based on the DPK24-JK4, as a template and six mutagenic PCR primers (primer 1, 5′-GAGCCGCACGAGCCCGAGCTCGTGATGAC(C/T)CAGTCTCC; primer 2, 5′-CTTATTGTTGCTGCTGTATAAAAC; primer 3, 5′-CAGCAGCAACAATAAGAACTACTT; primer 4, ATATTGCTGACAGTAATAAAC; primer 5, 5′-TATTACTGTCAGCAATATTATTCCTATCCGTTGACGTTCGGCCAAGGGACC; primer 6, 5′-GCGCCGTCTAGAATTAACACTCTCCCCTGTTGAAGCTCTTTGTGACGGGCGAACTCAG). Primers 1 and 6 contain HindIII and SalI sites, respectively. The final PCR products were digested with HindIII and SalI and then subcloned into pBluescript SK(+) to yield pBL/HzK. After confirming the sequence, the humanized VL was fused to human Cκ in pCLS2-hygro by recombinant PCR. The final PCR product was digested with HindIII and XbaI and then subcloned into the HindIII-XbaI sites of pdCMV-dhfr (Aprogen) to yield pdCMV-dhfr-HzK. To construct a humanized VH, initially, the HCDR1, the SDRs in the HCDR2 (HSDR2), the HCDR3, and two FR3 residues (Ala71 and Lys73) of CC49 were grafted onto DP25-JH4 to construct the VH of a humanized heavy chain (aka). The sequences of the mouse, human, and humanized VH are shown in Fig. 1B. The humanized VH was synthesized by recombinant PCR using a humanized VH (pCHS-neo) (32Ryu C.J. Padlan E.A. Gripon P. Guguen-Guillouzo C. Yoo O.J. Hong H.J. Human Antibodies Hybridomas. 1996; 7: 113-122Crossref PubMed Scopus (23) Google Scholar), which is also based on human DP25-JH4, as a template and eight mutagenic PCR primers (primer 9, 5′-CTGCTCGAGTCTGGGGCTGAAGT; primer 10, 5′-AATTGCATGGTCAGTGAAGGTGTAGCCAGA; primer 11, 5′-ACTGACCATGCAATTCACTGGGTGCGCCAG; primer 12, 5′-ATCATCGTTGCCAGGAGAAAAATATCCCATCCACTCAAG; primer 13, 5′-TTTTCTCCTGGCAACGATGATTTTAAATACTCCCAGAAGTTC; primer 14, 5′-GTCTGCAGTGATTGTCACGC; primer 15, 5′-ACTGCAGACAAATCCGCGAG; primer 16, 5′-CATATTCAGAGATCTTGTACAG(A/T)AATAGACCGCCGTGTC; primer 17, 5′-ACAAGATCTCTGAATATGGCTTACTGGGGCCAAGGGACT; primer 18, 5′-GCATGTACTAGTTTTGTCACAAGATTTGG). Primers 9 and 18 contained EcoRI and SalI sites, respectively. The humanized VH was fused to human Cγ1 in pCHS2-neo (31Park S.S. Nam K.-Y. No K.T. Ryu C.J. Gripon P. Guguen-Guillouzo C. Hong H.J. Hybridoma. 1996; 15: 435-441Crossref PubMed Scopus (16) Google Scholar) by recombinant PCR. The final PCR product was digested with EcoRI and SalI and then subcloned into pdCMV-dhfr to yield pdCMV-dhfr-akt. Another humanized heavy chain aka was constructed from akt by recombinant PCR using pdCMV-dhfr-akt as a template and mutagenic PCR primers; this was then subcloned into the EcoRI-ApaI sites of pdCMV-dhfr-akt to construct pdCMV-dhfr-aka. Expression and Purification of Humanized Antibody—The humanized antibody was transiently expressed in COS7 cells using Lipofectamine (Invitrogen), and the culture supernatant was subjected to ELISA to determine its antigen-binding activity and affinity. For the stable expression of humanized antibody, expression plasmid DNA was transfected into a dihydrofolate reductase-deficient Chinese hamster ovary (CHO) cell line, DG44. After selection in minimal essential medium α containing G418 in 96-well plates, the resistant cell clones were screened for the production of assembled antibody by an indirect ELISA and were subjected to stepwise methotrexate adaptation, as described previously (33Kim S.J. Jang M.H. Stapleton J.T. Yoon S.O. Kim K.-S. Jeon E.-S. Hong H.J. Virology. 2004; 318: 598-607Crossref PubMed Scopus (28) Google Scholar). For the production and purification of antibody, the CHO cell line that stably expressed the antibody was grown in serum-free medium (CHO-SFM II, Invitrogen), and the culture supernatant was subjected to affinity chromatography on a Protein G-Sepharose column (Amersham Biosciences), as described previously (32Ryu C.J. Padlan E.A. Gripon P. Guguen-Guillouzo C. Yoo O.J. Hong H.J. Human Antibodies Hybridomas. 1996; 7: 113-122Crossref PubMed Scopus (23) Google Scholar). The integrity and purity of the purified antibody were determined by SDS-PAGE. For quantification of the purified antibody, an optical density of 1.43 at 280 nm was used for a protein concentration of 1 mg/ml (34Coligan J.E. Kruisbeek A.M. Margulies D.H. Shevach E.M. Strober W. Current Protocols in Immunology. National Institutes of Health, Bethesda, MD1991: 2.7.1-2.7.5Google Scholar). ELISA—For an indirect ELISA, antibody samples were added to each well that had been coated with 1 μg of TAG-72-positive bovine submaxillary mucin (Type I-S; Sigma), as described previously (27Tamura M. Milenic D.E. Iwahashi M. Padlan E. Schlom J. Kashmiri S.V.S. J. Immunol. 2000; 164: 432-441Crossref Scopus (50) Google Scholar), and were incubated at 4 °C overnight. After washing, 100 μl of goat anti-human IgG-horseradish peroxidase conjugate (1:1000 (v/v); Sigma) were added to each well and incubated at 37 °C for 1 h. Finally, 100 μl of 0.2 m citrate-PO4 buffer (pH 5.0) containing 0.04% o-phenylenediamine (Invitrogen) and 0.03% H2O2 were added to each well and incubated for 10 min. The reaction was stopped by the addition of 50 μl of 2.5 m H2SO4, and the optical density was measured at 492 nm in an ELISA plate reader (Titertek Multiskan Plus). To determine antigen-binding affinity, a competition ELISA was carried out as described previously (32Ryu C.J. Padlan E.A. Gripon P. Guguen-Guillouzo C. Yoo O.J. Hong H.J. Human Antibodies Hybridomas. 1996; 7: 113-122Crossref PubMed Scopus (23) Google Scholar). Briefly, solutions containing 3 ng of each antibody and various concentrations (10–11–10–5 m) of bovine submaxillary mucin as a competing antigen were incubated at 37 °C for 2 h and were then added to each well that had been previously coated with 200 ng of the antigen. The bound antibody was detected by an indirect ELISA. The dissociation constant (KD) of each antibody was calculated from a Scatchard plot (35Friguet B. Chaffotte A.F. Djavadi-Ohaniance L. Goldberg M.E. J. Immunol. Methods. 1985; 77: 305-319Crossref PubMed Scopus (1119) Google Scholar). To analyze the epitope specificity of 3E8, a competition binding assay between CC49 and 3E8 was performed as described previously (33Kim S.J. Jang M.H. Stapleton J.T. Yoon S.O. Kim K.-S. Jeon E.-S. Hong H.J. Virology. 2004; 318: 598-607Crossref PubMed Scopus (28) Google Scholar). Briefly, CC49 or biotinylated 3E8 was incubated with bovine submaxillary mucin (250 ng/well; Sigma) in 96-well plates at 37 °C for 30 min in the presence of increasing concentrations of a competing antibody, 3E8. The bound CC49 or biotinylated 3E8 was detected by goat anti-mouse IgG (Fc-specific)-horseradish peroxidase conjugate (Pierce) or streptavidin-horseradish peroxidase (Sigma), respectively. As a negative control of the competing antibody, humanized KR127, which specifically binds to the preS1 antigen of hepatitis B virus (36Hong H.J. Ryu C.J. Hur H. Kim S. Oh H.K. Oh M.S. Park S.Y. Virology. 2004; 318: 134-141Crossref PubMed Scopus (70) Google Scholar), was used. Serum Reactivity Assay—The potential immunogenicity of AKA in humans was assessed by measuring the reactivity of the humanized antibody to the serum from patient EA, who received 177Lu-mCC49 in a phase I radioimmunotherapy trial (22Mulligan T. Carrasquillo J.A. Chung Y. Milenic D.E. Schlom J. Feuerstein I. Paik C. Perentesis P. Reynolds J. Curt G. Goeckeler W. Fordyce W. Cheng R. Riseberg D. Cowan K. O'Shaughnessy J. Clin. Cancer Res. 1995; 1: 1447-1454PubMed Google Scholar). Since the serum from patient EA contained anti-murine variable region antibodies, it was used to compare the reactivity of AKA with that of HuCC49. However, the serum also contained circulating TAG-72 antigen and anti-murine Fc antibodies, which may have interfered with the binding of the humanized antibody to the anti-variable region antibodies in the serum. Therefore, prior to the serum reactivity assay, TAG-72 antigen and anti-murine Fc antibodies were removed from the serum by immunoadsorption to another TAG-72-specific murine mAb, CC92, that recognizes an epitope of TAG-72 that is distinct from the one recognized by CC49 (37Kuroki M. Fernsten P.D. Wunderlich D. Colcher D. Simpson J.F. Poole D.J. Schlom J. Cancer Res. 1990; 50: 4872-4879PubMed Google Scholar). Briefly, CC92 was coupled to Reactigel (HW65F; Pierce). The patient serum was added to the CC92 gel and was incubated overnight at 4 °C with end-over-end rotation. The samples were centrifuged at 1000 × g for 5 min, and the supernatants were saved and stored at –20 °C for the serum reactivity assay. To test the serum reactivity of antibodies, a surface plasmon resonance-based competition assay was carried out using a BIAcore X instrument (BIAcore), as described previously (38Gonzales N.R. Schuck P. Schlom J. Kashmiri S.V.S. J. Immunol. Methods. 2002; 268: 197-210Crossref PubMed Scopus (40) Google Scholar). Briefly, proteins were immobilized on the carboxymethylated dextran chip (CM5) by amine coupling. The dextran layer of the sensor chip was activated by injecting 35 μl of a mixture of N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride and N-hydroxysuccinimide at a flow rate of 5 μl/min. Proteins diluted in 10 mm sodium acetate buffer (pH 5.0) at a concentration of 100 μg/ml were injected until surfaces of 5000 resonance units were obtained. The remaining reactive groups on the surfaces were blocked by injecting 35 μlof1 m ethanolamine (pH 8.5). To determine the serum reactivity of HuCC49 and AKA, AKA or HuCC49 at different concentrations was incubated with the patient serum cleared of TAG-72 and anti-murine Fc antibodies at 25 °C, and then the mixture was applied to the HuCC49-immobilized CM5 chip in flow cell 1 and a rabbit γ-globulin-immobilized chip in flow cell 2 as a reference to compete for binding to serum anti-variable region antibodies. After the binding was measured for 1000 s, the unbound samples were washed from the surface with running buffer using a flow rate of 100 μl/min, and the surfaces were regenerated with a 1-min injection of 10 mm glycine (pH 2.0). The percentage of binding at each antibody concentration was calculated as follows. Percentage of binding = (slope of the signal obtained with competitor (serum + antibody)/slope of the signal obtained without competitor (serum only)) × 100. The IC50 for each antibody was calculated as the concentration required for 50% inhibition of the binding of the serum to immobilized HuCC49. Affinity Maturation of AKA—To improve the affinity of AKA, the HCDR3 of AKA Fab was randomly mutated, and the resulting Fab library was subjected to a modified colony lift assay (39Radosevic K. Voerman J.S.A. Hemmes A. Muskens F. Speleman L. de Weers M. Rosmalen J.G.M. Knegt P. van Ewijk W. J. Immunol. Methods. 2003; 272: 219-233Crossref PubMed Scopus (5) Google Scholar). To begin, the Fab expression vector, pC3Q-dgIII, was constructed by deletion of the geneIII from pComb3H (40Barbas III, C.F. Bain J.D. Hoekstra D.M. Lerner R.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4457-4461Crossref PubMed Scopus (312) Google Scholar) and by replacement of the first amino acid residue, glutamic acid, by glutamine. Next, the VH of aka and the VL of HzK were subcloned into the XhoI-ApaI and SacI-XbaI sites, respectively, of pC3Q-dgIII to construct pC3Q-dgIII-AKA. This plasmid DNA was used as a template for random mutagenesis of the HCDR3 by recombinant PCR. The first PCR was performed using the 5′ and 3′ primers, VH135 and HCDR3 BACK, respectively, or HCDR3 FORWARD and LHS11, respectively. The HCDR3 FORWARD primer was mutagenic and introduced random mutations at the first five amino acid residues of the HCDR3 of AKA. The nucleotide sequences of the primers were as follows: VH135, 5′-AGGTGCAGCTGCTCGAGTCTGG; HCDR3 BACK, 5′-TCTTGCACAGTAATAGACCGCCGTGTC; HCDR3 FORWARD, 5′-GTCTATTACTGTGCAAGA(G/A/T/C)N-(G/C)NNSNNSNNSNNSTACTGGGGCCAAGGCACTCTG; LHS11, 5′-CACCGGTTCGGGGAAGT. The two first PCR products were then subjected to recombinant PCR. The final PCR product was digested with XhoI and ApaI and was cloned into the XhoI-ApaI sites of pC3Q-dgIII-AKA to create a mutant Fab library. After the transformation of Escherichia coli TG1 with the library, 106 cells were pipetted onto a nitrocellulose membrane placed on a 2× YTA plate and were grown overnight at 37 °C (master membrane). A nitrocellulose membrane was coated with antigen by incubation in PBS containing 10 μg/ml bovine submaxillary mucin at 37 °C for 6 h, rinsed twice with PBS, and blocked with 5% skim milk at 37 °C for 2 h. The blocked membrane was rinsed twice with PBS and soaked in 2× YT broth with 1 mm isopropyl-β-d-thiogalactopyranoside and 100 μg/ml ampicillin (capture membrane). This capture membrane was placed on a2× YTA plate containing 1 mm isopropyl-β-d-thiogalactopyranoside, and the master membrane was placed, cell-coated side up, on top of the capture membrane; the membranes were then incubated at room temperature overnight. The capture membrane was rinsed five times with PBS containing 0.05% Tween 20 (PBST), blocked with 5% skim milk at 37 °C for 6 h, and incubated with goat anti-human IgG F(ab′)2-horseradish peroxidase conjugate (1:1000 (v/v); Sigma) at 37 °C for 1 h. After washing, the membrane was developed by enhanced chemiluminescence, and the spots generated on the film were used to identify the corresponding colonies on the original bacterial plate. Each positive colony was grown in 2× YTA and subjected to another round of selection as described above. Finally, 180 positive colonies were isolated, and the antigen-binding activity of soluble Fab was measured by an indirect ELISA. The Fabs with high affinity were selected, and the nucleotide sequences of the HCDR3 were determined. Conversion of Fab to Whole IgG—The VH of selected Fab and Ig heavy chain leader sequences (32Ryu C.J. Padlan E.A. Gripon P. Guguen-Guillouzo C. Yoo O.J. Hong H.J. Human Antibodies Hybridomas. 1996; 7: 113-122Crossref PubMed Scopus (23) Google Scholar) were fused by recombinant PCR. The PCR products were digested with EcoRI and ApaI and were subcloned into the EcoRI-ApaI site of pdCMV-dhfr-AKA. The resulting expression plasmid was transfected into COS7 cells, and the antibody secreted in the culture supernatant was analyzed by ELISA to determine the antigen-binding affinity. Radioiodination of Humanized Antibody—The IODO-BEAD method (Pierce) was used for radiolabeling the purified AKA and 3E8 with 125I (Amersham Biosciences) or 131I (Korea Atomic Energy Research Institute). The radiolabeled antibody was purified by gel filtration on a PD-10 column (Amersham Biosciences) and was sterilized by filtration (0.22 μm; Millipore Corp.). The radiolabeling yield and radiochemical purity were determined with instant thin layer chromatography-silica gel (Gelman Scientific) in the stationary phase and 70% methanol in the mobile phase. Biodistribution Study—Female athymic mice (BALB/c-nu/nu; 5–6 weeks old; 17–23 g) were obtained from Japan SLC, Inc. Tumors were grown after a subcutaneous injection of 5 × 106 human colon adenocarcinoma cell line (LS174T) in the left thigh. After 14 days, 125I-3E8 or 125I-AKA (20 μg/740 KBq) were injected into the tail vein of the athymic mice bearing LS174T tumors. For each time point, a group of three mice was sacrificed to collect and weigh blood, tumors, and organs. Radioactivity was measured in a γ-scintillation counter. The percentage of the injected dose/g of tissue was calculated. Radioimmunotherapy Studies—The radioimmunotherapeutic efficacy of 131I-3E8 was evaluated in the athymic mice bearing LS174T tumors. For the tumor growth inhibition study (n = 8), LS174T cells (5 × 106) were subcutaneously injected into the back of athymic mice
Approved COVID-19 vaccines primarily induce neutralizing antibodies targeting the receptor-binding domain (RBD) of the SARS-CoV-2 spike (S) protein. However, the emergence of variants of concern with RBD mutations poses challenges to vaccine efficacy. This study aimed to design a next-generation vaccine that provides broader protection against diverse coronaviruses, focusing on glycan-free S2 peptides as vaccine candidates to overcome the low immunogenicity of the S2 domain due to the N-linked glycans on the S antigen stalk, which can mask S2 antibody responses. Glycan-free S2 peptides were synthesized and attached to SARS-CoV-2 virus-like particles (VLPs) lacking the S antigen. Humoral and cellular immune responses were analyzed after the second booster immunization in BALB/c mice. Enzyme-linked immunosorbent assay revealed the reactivity of sera against SARS-CoV-2 variants, and pseudovirus neutralization assay confirmed neutralizing activities. Among the S2 peptide-conjugated VLPs, the S2.3 (N1135-K1157) and S2.5 (A1174-L1193) peptide–VLP conjugates effectively induced S2-specific serum immunoglobulins. These antisera showed high reactivity against SARS-CoV-2 variant S proteins and effectively inhibited pseudoviral infections. S2 peptide-conjugated VLPs activated SARS-CoV-2 VLP-specific T-cells. The SARS-CoV-2 vaccine incorporating conserved S2 peptides and CoV-2 VLPs shows promise as a universal vaccine capable of generating neutralizing antibodies and T-cell responses against SARS-CoV-2 variants.
Therapeutic antibodies represent one of the fastest growing areas of the pharmaceutical industry. There are currently 19 monoclonal antibodies in the market that have been approved by the FDA and over 150 in clinical developments. Driven by innovation and technological developments, therapeutic antibodies are the second largest biopharmaceutical product category after vaccines. Antibodies have been engineered by a variety of methods to suit a particular therapeutic use. This review describes the structural and functional characteristics of antibody and the antibody engineering for the generation and optimization of therapeutic antibodies.
Back Cover In article number 2101516, Dae-Hyuk Kweon and co-workers show that the cooperation of antibodies and nanodiscs disrupts the influenza virus inside infected cells. This cooperation provides the virus-infected host cells with the ability to self-eliminate the virus.
Pluripotent human embryonic stem cells (hESCs) provide appropriate systems for developmental studies and prospective donor cell sources for regenerative medicine. Identification of surface markers specific to hESCs is a prerequisite for studying hESC biology and can be used to generate clinical-level donor cell preparations that are free from tumorigenic undifferentiated hESCs. We previously reported the generation of monoclonal antibodies that specifically recognize hESC surface antigens using a decoy immunization strategy. In this study, we show that monoclonal antibody 57-C11 recognizes a phosphorylated form of adenovirus early region 1B-associated protein 5 (E1B-AP5). E1B-AP5 is a nuclear RNA-binding protein, but we report that 57-C11-reactive E1B-AP5 is expressed on the surface of undifferentiated hESCs. In undifferentiated hESCs, 57-C11-reactive E1B-AP5 is localized to SSEA3-, SSEA4-, TRA-1-60-, TRA-1-81-, OCT4-, SOX2-, and NANOG-positive hESCs. In mixtures of undifferentiated hESCs and hESC-derived neurons, 57-C11 exclusively recognizes undifferentiated hESCs but not hESC-derived neuronal cells. Further, the expression of 57-C11-reactive E1B-AP5 decreases upon differentiation. Our results demonstrate that 57-C11-reactive E1B-AP5 is a novel surface molecule that is involved in the undifferentiated state of hESCs. As far as we know, this is the first report demonstrating that heterogeneous nuclear RNA-binding protein is expressed on the surface of undifferentiated hESCs.
'%3e%3cg id='b'%3e%3cpath id='a' stroke='%23000' stroke-width='2' d='M-6-25H6m-12 3H6m-12 3H6'/%3e%3cuse xlink:href='%23a' y='44'/%3e%3c/g%3e%3cpath stroke='%23fff' d='M0 17v10'/%3e%3ccircle r='12' fill='%23cd2e3a'/%3e%3cpath fill='%230047a0' d='M0-12A6 6 0 0 0 0 0a6 6 0 0 1 0 12 12 12 0 0 1 0-24z'/%3e%3c/g%3e%3cg transform='rotate(-123.69)'%3e%3cuse xlink:href='%23b'/%3e%3cpath stroke='%23fff' d='M0-23.5v3M0 17v3.5m0 3v3'/%3e%3c/g%3e%3c/svg%3e)